Labshake search
Citations for Roche :
501 - 550 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... N3500], 50 mM of Tris [pH 7.5], 150 mM of NaCl, 3 mM of MgCl2, 1X protease inhibitors [Roche, Mannheim, Germany; 05892953001]). Protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: Total protein from cells or mouse tissues (n=3 per genotype) were extracted using the M-PER protein lysis buffer (ThermoScientific, Beverly, MA) containing protease inhibitors (Roche, Indianapolis, IN). Approximately 25 μg of total protein was electrophoresed on 4-12% SDS-PAGE gels and transferred to PVDF membranes ...
-
bioRxiv - Physiology 2022Quote: ... n=3/genotype) were used for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to visualize cell apoptosis/death (Roche, Basel, Switzerland). Sections were counterstained with DAPI and visualized using epifluorescence (Nikon Eclipse Ni E800) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Genomics 2022Quote: ... Empty/filled PCRs (combining 5′ and 3′ flanking primers) and full-length PCRs (using junction-spanning primers) were performed using an Expand Long Range dNTPack (Roche, Cat#: 4829034001). Reaction mixes contained 5μL 5× Expand Long Range Buffer with 12.5mM MgCl2 ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were blocked for 1 h with 3% (w/v) non-fat milk powder in PBS/0.1% (v/v) Tween (PBST) (CALR, 10% Roche WBR in PBST) and incubated with primary antibody (Supplementary Table III ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Microbiology 2020Quote: ... and prepared for shotgun metagenomic sequencing using the Kapa Hyperprep Plus kit with 3 rounds of PCR amplification (Kapa Biosystems, Wilmington, MA), and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼0.5×106cells were collected and wash 3 times with Wash buffer (20 mM HEPES-KOH, pH 7.5,150mM NaCl, 0.5mM Spermidine, and Roche Complete Protease Inhibitor EDTA-free). Cells were captured with BioMagPlus Concanavalin A (Polysciences ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR reactions were carried out in triplicates following a 3-step amplification protocol using the LightCycler 480 system (Roche Diagnostics, Switzerland). The ΔΔCT method [94] was used to calculate gene expression changes relative to housekeeping genes β-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM β-mercaptoethanol (BME) and 0.3 μg/ml DNase I supplemented with 600 μl of protease inhibitor cocktail (Roche, Basel, Switzerland) and 5 mg lysostaphin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Immunology 2024Quote: ... tissue sections (n = 2-3 per tissue type) underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reaction volumes were increased to 50 ul and 3 μl was subsequently used for qPCR reactions with SYBR Green (Roche, cat# 04887352001). Forward primers were designed at the 5’ ending of tRNAs and the reverse primers were designed against the 3’adapter while specificity was created against the 3’ endings ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and Lactate dehydrogenase (LDH) assay kit (LDH Cytotoxicity Detection KitPLUS) were obtained from Roche (Germany). MG-63 cell line (National Cell Bank of Iran (NCBI) ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2 μg ml−1 collagenase A (Roche), 2.4 U ml−1 dispase I (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 mg ml-1 collagenase/ dispase (Roche) and 0.2 mg ml-1 DNase I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... and 10 U mL−1 IL-2 (Roche) for 48 h at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 mM PMSF and 1 % protease inhibitor (Roche). The samples were then lysed by sonication and centrifuged to collect the supernatant for the following protein purification ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After incubation for 1-2 hours in a 1% blocking solution (Roche) dissolved in 1× PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% sodium deoxycholate, 50 mM NaF, 2 mM EDTA, 2 mM DTT, 0.2 mM Na orthovanadate, 1 X Roche protease inhibitor #11836170001). Lysates were sonicated and centrifuged to remove debris ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a 2:1:1 ratio using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...