Labshake search
Citations for Roche :
201 - 250 of 7621 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were subsequently transferred to 384-well plates for analysis by RT-qPCR on the 480 Real-Time PCR system (Roche, Basel, Switzerland) using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA was added to optimized 10 µM primer/probe mix in Mastermix (Quantabio, qScript™ XLT One-Step RT-qPCR ToughMix®) and run on StepOne Plus real-time PCR (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Gene expression levels were quantified by Reverse Transcription quantitative polymerase chain reaction (RT–qPCR) using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). Cycling parameters were set at (i ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers for pmp-3 and ACTIN were used as housekeeping for C ...
-
bioRxiv - Plant Biology 2023Quote: ... We used the SYBR Premix Ex Taq II reagent kit (Vazyme, Q311-02) to perform qRT-PCR on a LightCycler 96 Real-Time PCR System (Roche). Rice OsACTIN1 was used as the internal reference ...
-
bioRxiv - Plant Biology 2023Quote: Quantitative real-time PCR (qRT-PCR) analysis was performed using the KAPA SYBR FAST qPCR kit (KAPA Biosystems Inc., Switzerland) to check the gene expression levels of GLXI;1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using the SYBR Green PCR Master Mix (Roche) on a ViiA7 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Immunology 2019Quote: ... PCR reactions were performed on the LightCycler®480 Real Time PCR System (Roche) using the FastStart SYBR Green Master Mix (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... using SYBR Green PCR master mix on the LC480 Real-Time PCR System (Roche) and the primer sequences reported in Supplemental Table 3 ...
-
bioRxiv - Neuroscience 2019Quote: ... using SYBR Green PCR master mix on the LC480 Real-Time PCR System (Roche) and the primer sequences indicated in Table 3 ...
-
bioRxiv - Neuroscience 2022Quote: QRT-PCR was performed using a SYBR Green I real-time PCR method (Roche, LightCycler® 480 SYBR Green I Master ...
-
bioRxiv - Immunology 2022Quote: ... PCR reactions were performed on the LightCycler® 480 Real Time PCR System (Roche) using the FastStart SYBR Green Master Mix (Roche) ...
-
bioRxiv - Immunology 2019Quote: ... PCR reactions were performed on the LightCycler® 480 Real Time PCR System (Roche) using the FastStart SYBR Green Master Mix (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR reactions were performed on a LightCycler 480 II Real Time PCR Instrument (Roche) and analyzed using LightCycler 480 Software ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR was performed with Roche LightCycler 480 Real Time PCR system (Roche, Switzerland) using LightCycler 480 SYBR Green Master (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The real time PCR program of the quantitative PCR (LightCycler480 II, Roche, Basel, Switzerland) was arranged as follows ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real time PCR was performed on Light cycler 480 (Roche) instrument with Kapa Sybr Fast Universal qPCR master mix (Cat ...
-
bioRxiv - Microbiology 2019Quote: ... and the Light Cycler 480 real-time PCR system (Roche, Switzerland); cycling conditions were as follows ...
-
CRISPR-SID: identifying EZH2 as a druggable target for desmoid tumors via in vivo dependency mappingbioRxiv - Cancer Biology 2021Quote: ... combined with a LightCycler® 480 Real-Time PCR System (Roche). Expression was normalized to housekeeping genes Actb ...
-
bioRxiv - Cell Biology 2019Quote: ... Real time quantitative PCR was performed using SYBR Green (Kapa Biosystems) or TAQMAN probes (details provided in supplementary table 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real time PCR analysis was performed using SYBR green mix (Roche) and the values were normalized to β-actin values ...
-
bioRxiv - Cell Biology 2019Quote: ... in a LightCycler 480 Real-Time PCR System (Roche Applied Science) as follows ...
-
bioRxiv - Microbiology 2021Quote: ... and the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). RNA extraction was performed using the Roche High Pure Viral RNA Kit (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... in a LightCycler 480 Real Time PCR system (Roche, Basel, Switzerland) for qRT-PCR analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time PCR was performed using LightCycler96 (Roche Applied Science) with FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative real-time PCRs were performed on a LightCycler 480 (Roche) with SYBR Green I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... was used with a LightCycler 480 Real-Time PCR System (Roche) as previously described (38) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The real-time PCR was performed on a Lightcycler 480 (Roche) using the SYBR Green I Master PCR kit with gene-specific primers ...
-
bioRxiv - Genomics 2022Quote: ... Real time PCR was carried out using the LC480 Thermocycler (Roche) using SYBR Green chemistry (Fermentas Intl ...
-
bioRxiv - Genomics 2022Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2019Quote: ... on a Light Cycler LC480 Real-Time PCR system (Roche, France) in 384 well plates with 2 ng of equivalent RNA per point of qPCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR was performed using SYBR Green I (Roche, USA). Amplification was performed as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time quantitative PCR analysis was performed on a LightCycler480 (Roche) real-time PCR system using SybrGreen as well as TaqMan technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative real-time PCRs were performed on a LightCycler 480 (Roche) with SYBR Green I (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Real-time PCR was performed in a LightCycler 480 (Roche Diagnostics), using the LightCycler 480 SYBR Green I Master Kit (Roche Diagnostics ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... on the LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). ORF 1ab was amplified from cDNA and cloned into MS2-nCoV-ORF1ab and used as the plasmid standard after its identity was confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 μL KAPA HiFi Real Time PCR master mix (KAPA Biosystems) and 9 μL size selected DNA solutions in a total reaction volume of 20 μL ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative PCR was performed with the Applied BiosystemsTM PowerUP™ SYBR™ Green Master Mix from Applied Biosystems on a real-time PCR instrument (LightCycler® 480 System, Roche) using the primers listed in Supplementary Table 2.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and run on a LightCycler 480 real-time PCR instrument (Roche). The quantified libraries were prepared for sequencing utilizing a TruSeq paired-end cluster kit (v3) ...
-
bioRxiv - Plant Biology 2021Quote: ... in a LightCycler 480 Real-Time PCR System (Roche, Basal, Switzerland). Expression levels were normalized by ACTIN2 (ACT2) ...
-
bioRxiv - Cell Biology 2021Quote: ... using LightCycler ® 96 Real-Time PCR System (Roche Life Science). The specificity of the primers was verified with a single peak in the melt curve ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was carried out on LightCycler®480 (Roche) using SYBR-green ...
-
bioRxiv - Molecular Biology 2021Quote: Quantitative real time PCR was performed using SYBR green chemistry (Roche) with specific set of primer pairs (Supp Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was performed on a LightCycler480 system (Roche) using SYBR Green Master Mix (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time PCR was performed by using Roche LightCycler96 (Roche, 05815916001) system and SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR was performed with SYBR Green I (Roche) using a CFX96 Touch Real-Time PCR Detection System (BIORAD) ...
-
bioRxiv - Genetics 2022Quote: ... on a LightCycler 480 Real-Time PCR System (Roche, Applied Science).2 µL (3 ng ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Neuroscience 2023Quote: ... The Light Cycler® 480 Real-Time PCR System (Roche, Germany) was used to perform qPCR.
-
bioRxiv - Cancer Biology 2023Quote: ... and the LightCycler® 480 Real-Time PCR (Roche Life Science) system ...