Labshake search
Citations for Roche :
1 - 50 of 7621 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time RT-PCR was carried out using Real-Time PCR Master Mix (KAPA Biosystems) and following probes and primers on a 7300 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: Real-time RT-PCR analysis was performed on a LightCycler 480 Real-Time system (Roche) for 45 cycles ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCRs were run in a 7500 real-time PCR system (Roche) using the following settings ...
-
bioRxiv - Microbiology 2020Quote: ... previously published assay (“one-step real-time RT-PCR E assay”) using the One-Step RT-qPCR kit (Roche Diagnostics). For each run ...
-
bioRxiv - Neuroscience 2021Quote: ... on a LightCycler 480 Instrument II Real-Time PCR Detection System (Roche). Primer sequences are provided in the Table 1 ...
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time RT-PCR was performed with LightCycler® 480 II (Roche) using DyNAmo ColorFlash SYBR Green (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT products were amplified by real time PCR (LightCycler™ 480, Roche) using SYBR Green I Master mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...
-
bioRxiv - Biochemistry 2022Quote: ... I analyzed samples by real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) using a Light Cycler 1.5 (Roche Diagnostics). Measurements form RNA of vascular cell adhesion molecule-1 (VCAM-1 ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR was performed with LightCycler 480 SYBR Green I Master detection kit (Roche 04707516001) on a Light Cycler 480 machine (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... One step real time RT-PCR was performed using the RNA Process Control Kit (Roche, Basel, Switzerland) with 5 μl of extracted RNA or directly from 5 μl of heated sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche) in a Light Cycler instrument (Roche Applied Science ...
-
bioRxiv - Neuroscience 2019Quote: ... in a real-time quantitative PCR (qPCR) detection system (LC480, Roche, Basel, Switzerland) using the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using the Real-Time PCR System (LightCycler 96, Roche). Each reaction comprised of 0.5 µL of diluted cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... The RT product was amplified by LightCycler 480 Real-Time PCR system (Roche) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative real time PCR (RT-qPCR) was performed on a LightCycler 480 (Roche). cDNAs were synthesized from 500ng of total RNA using the SuperScript™ III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche) using the Light Cycler FastStart DNA Master SYBERGreen I kit (Roche) ...
-
bioRxiv - Genomics 2022Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR master mix (Roche) to quantify the DNA recovery compared to ChIP input DNA at one embryo equivalency (percent input) ...
-
bioRxiv - Microbiology 2020Quote: Real time quantitative RT-PCR was performed with the Light Cycler RNA Master SYBR Green I kit (Roche), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2−ΔΔCt method.14 All primers are listed (Supplemental Table 2S).
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2-ΔΔCt method.65 All primers for target genes are listed (Supplemental Table 5S).
-
bioRxiv - Plant Biology 2019Quote: ... were used as template for quantitative real time RT-PCRs which were performed in 384-well plates using a LightCycler 480 II detection system (Roche Diagnostics, Mannheim, Germany). GoTaq PCR Mastermix (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time RT PCR was performed using FastStart Universal SYBR Green Master mix (Roche). Samples were analyzed in triplicate for β2-Microglobulin (B2M) ...
-
bioRxiv - Genetics 2019Quote: ... real-time RT-PCR was performed on a LightCycler® Nano (Roche, Mannheim, Germany). The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR was performed with a LightCycler 96 Real-Time PCR System (Roche Diagnostics), using HOT FIREPol EvaGreen qPCR Mix (Solis BioDyne ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time RT-PCR was then performed on a LightCycler™ system (Roche Diagnostics) using the light Cycler-DNA Master SYBR Green I mix ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Quantitative real-time RT-PCR analysis was performed using a Lightycycler 480 (Roche, Germany). Complementary DNA (10 ng) ...
-
bioRxiv - Neuroscience 2021Quote: Real-Time polymerase chain reaction (RT-PCR) was performed using SYBR green (04887352001, Roche) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was carried out with a LightCycler 480 Real-Time PCR System (Roche) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... RT-qPCR was performed with The Light cycle 96 Real-Time PCR System (Roche). The PCR-program ...
-
bioRxiv - Biochemistry 2023Quote: ... The RT product was amplified using the LightCycler 480 Real-Time PCR system (Roche) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... for real-time quantitative PCR (RT-qPCR) in a LightCycler®480 System (Roche). The following primers were used for determination of intracellular ZIKV genomes (fwd 5’ agatcccggctgaaacactg 3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time PCR was performed on a LightCycler 480 real-time PCR system (Roche) combined with the LightCycler 480 SYBR Green I master mix (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was conducted on Roche Lightcycler 96 Real time PCR system (Roche) with FastStart Essential DNA Green Master (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed on a Real-time system (Roche) using SYBR green supermix (Vazyme) ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using a One-step BrightGreen RT-qPCR Kit (Abm, G471-S) following the manufacturer’s protocol in the LightCycler 96 Real-Time PCR System (Roche). Isocitrate dehydrogenase (ICDH ...
-
bioRxiv - Genetics 2021Quote: ... was used for quantitative real-time PCR (RT-qPCR) analysis with a LightCycler 480 (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time RT-PCR was done using the LightCycler™ 480 system (Roche Applied Science). Samples were normalised to ornithine decarboxylase (odc ...
-
bioRxiv - Plant Biology 2020Quote: ... The RT-qPCR was carried out on a LightCycler 480 Real-Time PCR System (Roche). Three independent biological replicates of each condition and at least two technical replicates of each biological replicate were performed ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR assay was carried out in a LightCycler480 Real Time PCR system (Roche) using the TaqMan gene expression assay ...
-
bioRxiv - Physiology 2023Quote: ... Real-time quantitative polymerase chain reaction (RT-qPCR) was carried out in a LightCycler 480 detection system (Roche) using the LightCycler FastStart DNA Master plus SYBR Green I kit (Roche) ...
-
bioRxiv - Microbiology 2019Quote: One-step simplex real-time quantitative RT-PCR amplifications were performed using Multiplex RNA Virus Master Kit (Roche Diagnostics, France) for influenza A ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (Biolaps) according to the manufacturer protocol on a LightCycler real-time PCR thermocycler (Roche). The analysis of the infection rate based on PCR data was done with the binGroup package [42] in R software.
-
bioRxiv - Neuroscience 2023Quote: Real-time PCR analysis was performed with use of LightCycler 96 real-time PCR system (Roche). The PCR parameters were following ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR analysis was performed using a LightCycler® 96 Real-Time PCR System (Roche). Primers were designed for each gene with Primer3-0.4.0 software (http://bioinfo.ut.ee/primer3-0.4.0/) ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR analysis was performed using a LightCycler® 96 Real-Time PCR System (Roche). RT-qPCR reaction was prepared in triplicates by mixing 2.5 μl of a 25-fold diluted cDNA ...
-
bioRxiv - Physiology 2020Quote: ... Real-time PCR (LightCycler 480; Roche) was performed with diluted cDNAs in a 20-μl reaction volume in triplicate.