Labshake search
Citations for Roche :
351 - 400 of 7621 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST Universal reagent (Roche) using an Eppendorf Realplex2 cycler ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting cDNAs were examined by real-time PCR (LightCycler 480 II, Roche), and the cycle threshold was determined from the amplification curve as an index for relative mRNA content in each reaction.
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR reaction was performed on a Light Cycler 2 (Roche) using 10 μL SYBR Premix Ex Taq (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... Roche Flow (Roche MagNA Pure 96, Roche LightCycler 480 II real-time PCR), and Qiaflow (QIAsymphony or RotorGene ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was performed using a LightCycler® 480 Real-Time PCR System (Roche). qPCR reactions were done in duplicate for each sample ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative real-time PCR reactions were run on the LightCycler 480 instrument (Roche) using the PrimeTime Gene Expression Master Mix (IDT DNA ...
-
bioRxiv - Pathology 2022Quote: ... Quantitative real-time PCR was performed using FastStart SYBR Green Master mix (Roche) and QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... To measure mtDNA quantitative real time PCR was performed with SYBR green (ROCHE). The primer sequences used for mtDNA were ...
-
bioRxiv - Microbiology 2021Quote: ... The real time PCR was performed in a LightCycler 480 Instrument II (Roche) using the following programme ...
-
bioRxiv - Cell Biology 2020Quote: ... Transcript levels were determined by LightCycler 480 Real-Time PCR System from Roche, using SYBR green I Master from the same company ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative real-time PCR reactions were run on the LightCycler 480 instrument (Roche) using the PrimeTime Gene Expression Master Mix (IDT DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time PCR was performed using FastStart Universal SYBR Green Master (Rox) (Roche) and LightCycler384 (Roche) ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... and analyzed on a real-time PCR instrument (LightCycler 480, Roche Molecular Systems) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2019Quote: ... Quantitative real time PCR was performed on Light Cycler 480 II instrument (Roche) using Power SYBR™ Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative real-time PCR was performed on the cDNA using an LC480 (Roche) and the SYBR green assay ...
-
bioRxiv - Pathology 2020Quote: ... The samples were run on a LightCycler480 real-time PCR thermal cycler (Roche), and the relative ratio of the expression of each gene was calculated using the 2ΔΔCt method ...
-
bioRxiv - Genetics 2019Quote: ... the supernatant was subjected to real-time quantitative PCR with Lightcycler 480 (Roche). The primers for LEU3 on the genome or leu2d gene on pTOW40836 and SYBR Green I Master (Roche ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subjected to real-time PCR analysis in a LightCycler 480 instrument (Roche) with Thunderbird SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cp values were measured using a LightCycler 480 Real-Time PCR System (Roche). Relative fold-change in expression values were calculated using the following formula ...
-
bioRxiv - Physiology 2020Quote: ... in triplicates using LightCycler 480 Real-Time PCR System (Roche Diagnostics, Mannheim, Germany). All genes were normalized to β-actin ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was perfomed using a LightCycler® 480 Real-Time PCR System (Roche). qPCR reactions were done in duplicate for each sample ...
-
bioRxiv - Cell Biology 2021Quote: ... qChIPs were analysed by real-time PCR using Lightcycler 480 SYBR Green (Roche) Oligonucleotides are listed in Supp ...
-
bioRxiv - Immunology 2020Quote: ... was used for real-time PCR with a LightCycler® 480 system (Roche). The following primers were used for the assay ...
-
bioRxiv - Genetics 2019Quote: qChIPs were analysed by real-time PCR using Lightcycler 480 SYBR Green (Roche) with oligonucleotides listed in Supplementary Information Table S3 ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were carried out on a LightCycler 480 Real-Time PCR system (Roche) as follows ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were run in a LightCycler® 480 real time-PCR system (Roche). Viral titers were obtained by plaque assay.
-
bioRxiv - Cancer Biology 2022Quote: ... ß-Actin (ACTB): hs01060665_g1 on a LC480 Real Time PCR (Roche, Madrid, Spain). ACTB expression was used as the endogenous reference control using the comparative cycle threshold method ...
-
bioRxiv - Cell Biology 2022Quote: ... and real-time PCR was performed using SYBR Green I Master (Roche, #04707516001). The primers used for each transcript are listed in Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... We assessed the DNA library concentration through real-time PCR (Roche LightCycler 480) and SYBR Green chemistry (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-Time PCR analysis was conducted on a Light Cycler 480 system (Roche), and the data were processed and analyzed using the comparative ΔCT method (Livak and Schmittgen ...
-
bioRxiv - Pathology 2022Quote: ... on a commercially available real-time PCR platform (LightCycler 480, Roche Applied Sciences). The copy number estimate of MKPV DNA in each PCR test was calculated by plotting the real-time crossing point values from the MKPV PCR assay on a standard curve generated by testing log-fold dilutions of a known copy number positive control.
-
bioRxiv - Cell Biology 2022Quote: Quantitative real-time PCR was performed using Universal SYBR Green Master Mix (Roche) and analyzed using a Step One Plus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... quantitative real-time PCR was performed using a LightCycler Instument (Roche Diagnostics Corporation) using the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was carried using FastStart Universal Probe Master mix (ROX,Roche) and published primer concentrations.
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was then subjected to real-time PCR (LightCycler 96 sytem, Roche) by using FastStart Essential DNA Green Master (Roche ...
-
bioRxiv - Physiology 2023Quote: ... Real-time quantitative PCR analysis was performed using SYBR Green I Master (Roche) on LightCycler® 480 Real-Time PCR System ...
-
bioRxiv - Immunology 2023Quote: ... Transcripts were quantified by real time PCR on a 480 LightCycler instrument (Roche). Reactions were carried out in 10μL ...
-
bioRxiv - Biochemistry 2023Quote: ... in a real-time PCR device (Light Cycler 480, Roche Diagnostics, Mannheim, Germany). Fluorescence was recorded at 465 nm excitation and 580 nm emission wavelengths ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed on a LightCycler® 480 Real-Time PCR System (Roche) with AceQ qPCR SYBR Green Master Mix (Q111-02 ...
-
bioRxiv - Neuroscience 2023Quote: ... with the real-time PCR system (Light Cycler 480, Roche; or CFX384, BioRad). The number of such transgenes was quantified by absolute quantification methods against standard plasmids of pre-quantified concentration ...
-
bioRxiv - Genomics 2024Quote: Real-time quantitative PCR reactions were performed using a LightCycler 480 system (Roche) with SYBR Green 2× PCR Master Mix I (Roche ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR was performed using FastStart Universal SYBR Green master (Roche) and run on LightCycler 96 Systems (Roche) ...
-
bioRxiv - Immunology 2024Quote: ... Real-time PCR analysis was performed on LightCycler 480 II (Roche, Pleasanton, USA) equipped with SYBR green detector (TaKaRa Bio ...
-
bioRxiv - Immunology 2023Quote: ... using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc., Switzerland) with RT2 SYBR Green qPCR Mastermix (330501 ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed using Universal SYBR Green Master Mix (Roche) and analyzed using a Step One Plus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2024Quote: ... real-time PCR was performed using SYBR Fast qPCR Master Mix (Kapa Biosystems) and the CFX-96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Immunology 2020Quote: ... and a quantitative Real-Time PCR was performed according to the manufacturer’s instructions (MMLV Kit, Life Technologies and Smart SYBRGreen kit, Roche Applied Science). Circadian gene expression was investigated using specific primers targeting Bmal1 and Clock genes (8) ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using KOD SYBR qPCR (TOYOBO) and LightCycler 96 (Roche). Target gene expression was normalized on the basis of Gapdh content.
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Genomics 2022Quote: Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using KAPA SYBR FAST (Kapa Biosystems KK4610) on a 384-well LightCycler 480 Real-Time PCR System (Roche ...