Labshake search
Citations for Roche :
101 - 150 of 816 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 20 tablets/L complete EDTA-free protease inhibitor cocktail (Roche), 0.05 mg/mL DnaseI (from bovine pancreas) ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 tablets/L complete EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 250 mmol/L NaCl) containing protease inhibitor cocktail tablets (Roche). Samples were run alongside a Chameleon Duo protein ladder and transferred to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8% CHAPS with a cOmplete™ protease inhibitor cocktail tablet added (Roche, cat n°11697498001) for 10 min on ice and centrifuged for 15 min at 16,000 x g at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... with a primary antibody for α-syn (Novocastra N-ASYN, clone KM51, Roche; 1:25) and a secondary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using with FastStart Universal SYBR Green Master Mix (Roche, Cat. N° 4385610). Primers (Supplementary Table 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated O/N in the same solution containing 1:2,500 anti-digoxigenin antibody (Roche). The next day the embryos were washed in TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... Remaining lysate was rotated O/N with 25 µl of Protein-A-agarose beads (Roche) and 2 µg of mouse anti-HA antibody (Supplementary Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... + 0,4 g/l of human albumin (Vialebex) with Liberase TL (Roche) 150 ug/ml and DNase 1 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and 25 mg/l DNase I (grade II, Roche, Mannheim, Germany), pH 7.56 ...
-
bioRxiv - Immunology 2023Quote: ... or phytohemagglutinin-L (PHA) (10 μg/mL; Roche, San Diego, CA) and DMSO as positive and negative controls ...
-
bioRxiv - Immunology 2024Quote: ... 2mM L-glutamine and 1 mg/ml collagenase/dispase (Roche, #11097113001) and 20 µg/ml Recombinant RNase-free DNase I (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... L-lactate dehydrogenase and phosphoenolpyruvate were purchased from Roche (Manheim, Germany). HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% n-dodecyl β-D-maltoside [DDM] and 1X cOmplete™ EDTA-free protease inhibitor (Roche)) and incubated at 4°C for 30 mins ...
-
bioRxiv - Genomics 2021Quote: ... Second-stage digestion of SUMOylated peptides was performed with 1 μg of Endoproteinase Asp-N (Roche). Digestion was performed overnight ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Plant Biology 2023Quote: ... supplemented with 1% n-dodecyl β-D-maltoside (DDM) and protease inhibitor cocktail (4693116001, Roche, USA). Homogenization was achieved by gently mixing on ice for 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 10ng of total RNA were processed using the KAPA mRNA HyperPrep Kit (Roche p/n KK8580) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The recognized protein bands were visualized by 3,3 N-Diaminobenzidine tertrahydrochloride (DAB) solution staining (Roche, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... before being spotted in 2.5 mcl drops onto a dry nylon membrane (Hybond-N+, Roche 11417240001). Biotinylated oligo-dT (Promega Z5261 ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...