Labshake search
Citations for Roche :
101 - 150 of 8573 citations for N' 4 Dimethylamino phenyl methyl 5 methyl 1 2 oxazole 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were finally revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was determined by MTT (C, N-diphenyl-N′-4,5-dimethyl thiazol-2-yl tetrazolium bromide) assay (Roche, Switzerland), a standard colorimetric assay which uses the metabolic reduction of the tetrazolium salt to form the colored formazan product [33] ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6- Diamidin-2-phenylindol (DAPI, 1:1000, Roche Diagnostics GmbH ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Microbiology 2024Quote: rpoD was then amplified using psEG30F (5’-ATYGAAATCGCCAARCG-3’) and psEG790R (5’-CGGTTGATKTCCTTGA-3’) and KAPA2G Fast Hotstart Readymix (Roche-07960956001) to generate a 736 bp product as previously described (Girard et al ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Immunology 2024Quote: ... Sera were analysed for antibody directed against the SARS-CoV-2 Spike protein receptor-binding domain (S-RBD) and nucleocapsid (N) using an established automated electrochemiluminescence assay (Elecsys Anti-SARS-CoV-2 S and N, Roche diagnostics) [54] ...
-
bioRxiv - Developmental Biology 2024Quote: ... Real-time fluorescence-monitored quantitative PCR using the primer pair 5′-CCTATC ACCCTTGCCA-3′ and 5′-GAGGCTGTTGCTTGTG-3′ was performed on a LightCycler 96 System (Roche, Basel, Switzerland). Each reaction of 20 µL consisted of 10 µL of SYBR Green I (Roche) ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µg/ml of glycerol 3-phosphate dehydrogenase (Roche) and 5 µg of cell free protein extract ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6-Deamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000; Roche, #10236276001) for 20 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Neuroscience 2024Quote: 5’-bromo-2’-deoxyuridine (BrdU) (Roche, Indianapolis, IN) was dissolved in 0.9% NaCl and injected intraperitoneally (i.p. ...
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-GCTTGAGGTAGC CCTGTTGTCACC-3’ using KAPA HiFi Hotstart polymerase (Roche:KK2602). This PCR reaction produced a 185 bp wild type band and a 750 bp knockout band in heterozygous animals ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AGCGTTCACATCATATGGCA-3’) using Taq DNA polymerase (Roche, Cat. No. 11146165001). Fragments of foxl2l and id1 were cloned into pGEMT-easy plasmid by TA cloning while nanos2 fragment was cloned into pCS2+ plasmid by BamHI and KpnI ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Anti-FITC-POD (Roche Cat. N. 11426346910, 1:500).
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...