Labshake search
Citations for Roche :
2151 - 2200 of 7686 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Nucleo-cytoplasmic shuttling of splicing factor SRSF1 is required for development and cilia functionbioRxiv - Molecular Biology 2020Quote: ... This was followed by SybrGreen detection system (Lightcycler 2x SybrGreen Mix, Roche, #04707516001).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Chromosome slides were subjected to the detection with avidin-FITC (Roche, Basel, Switzerland) and then counterstained with DAPI in VECTASHIELD Antifade Mounting Medium (Vector Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... QPCR was performed using Roche’s SYBER Green detection in the Lightcycler 480 (Roche). Quantification of mRNA was performed by relative normalization to the constitutive gene GAPDH ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection was performed with the BM-chemiluminescence blotting substrate (Roche catalogue no 11500708001) and FusionFx7 imaging system (PeqLab) ...
-
Integrative analyses of the RNA modification machinery reveal tissue- and cancer-specific signaturesbioRxiv - Molecular Biology 2019Quote: ... Detection of the labelling was performed using the ChromoMAP DAB (760-159, Roche). Sections were counterstained with hematoxylin (760-2021 ...
-
bioRxiv - Microbiology 2020Quote: ... the labeled DNAs were detected using a CSPD-based chemiluminescence detection system (Roche) (26) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of tagged constructs was done using: HA-peroxidase antibody (Roche, ref: 12013819001), anti- TAP antibody (Thermofisher Scientific ...
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... The RNAs were visualized by using a detection system with digoxigenin (DIG) (Roche) and then captured using the imaging system ChemiDoc XRS Plus (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were lysed in Cell Death Detection Lysis Buffer (Roche, Basel, Switzerland) for analysis of insulin content ...
-
bioRxiv - Developmental Biology 2023Quote: ... Detection was performed using an anti-digoxigenin AP-conjugate antibody (Roche, Cat# 11093274910) followed by an NBT/BCIP reaction (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: ... Chemiluminescent detection of DIG-labelled DNA was carried using CDP-Star solution (Roche) before detection.
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed using KAPA SYBR® FAST Master Mix (KAPA Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... RT-qPCRs were performed using 1× LightCycler 480 SYBR Green I Master (Roche), 0.5 μM primers (Suppl ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-qPCR was performed on a LightCycler® 480 II (Roche Life Science) using SYBR® Premix Ex Taq(tm ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was subsequently performed as described [23] using Sybr green (Roche, 06924204001) on The LightCycler 480 System ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed using LightCycler 480 SYBR Green I master mix (Roche). For quantification of gene expression ...
-
bioRxiv - Immunology 2022Quote: ... slides were blocked at RT for 1 h in 1x Blocking reagent (Roche) and incubated at 4°C over night with a phospho-histone H2AX (pSer139 ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR assays were carried out on LightCycler LC480 II (Roche Diagnostics, Germany) using SYBR Green Jumpstart Taq Ready mix (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was performed using KAPA SYBR FAST qPCR master mix (Kapa Biosystems) with gene-specific primers (Supplementary Table 6 ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed in a LightCycler® 2.0 instrument (Roche, Mannheim, Germany), using 45 cycles of the following program ...
-
bioRxiv - Genetics 2019Quote: ... RT-qPCR reactions were carried out in quadruple on a LC480 machine (Roche). The reaction mix consisted of cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... a minimum of 50ng of RNA was used to prepare cDNA (Roche RT) and splice isoform specific PCRs were performed (Sigma Aldrich High fidelity Taq ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Plant Biology 2022Quote: ... Expression analysis by RT-qPCR was performed using SYBR Green master I (Roche) and the LightCycler® 96 system following a standard protocol (40 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed with the LightCycler® 480 Instrument (Roche Life Science) and data were analyzed according to manufacturer’s instruction (Roche LightCycler® 480 software ...
-
bioRxiv - Immunology 2023Quote: ... The RT-qPCR was run on a Roche LightCycler 480 (Roche Diagnostics Ltd) using the conditions outlined in Table 4.
-
bioRxiv - Molecular Biology 2023Quote: ... The RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using LightCycler 480 SYBR Green I Master mix (Roche) and run in a LightCycler 480 System (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... The expression of selected genes was measured by RT-qPCR (LightCycler 480; Roche), cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT qPCR samples were prepared using the KAPPA SYBR R fast (Roche, KK4611). Primer Sequences:
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was then performed using SYBR green master mix (Roche, Indianapolis, IN) and a Light Cycler 480 Instrument II (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and RT-qPCR was performed using SYBR green master mix (Roche, Indianapolis, IN) and a Light Cycler 480 Instrument II (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RT-qPCR cycling analysis was performed using a LC-480 device (Roche). qBasePlus software 3.2 (www.biogazelle.com ...
-
bioRxiv - Microbiology 2020Quote: ... Cobas PCR Media (Roche); Aptima Specimen Transport Medium (Hologic) ...
-
bioRxiv - Genomics 2022Quote: ... and quantitative PCR (Roche), according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR Free (KAPA Biosystems). Adaptor ligated DNA was treated with Lambda Exonuclease (NEB ...
-
bioRxiv - Immunology 2023Quote: ... PCR-free (Roche, #KK8503) with KAPA Unique-Dual Indexed (UDI ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Pathology 2022Quote: ... We used genomic DNA isolated from ear tissue with a High Pure PCR Template Preparation Kit (Roche Diagnostics, Basel, Switzerland). The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo ...
-
bioRxiv - Genomics 2022Quote: ... The libraries were quality controlled on an Agilent 2100 Bioanalyzer with the DNA 7500 assay for size and the concentration was estimated using quantitative PCR with the KAPA Library Quantification Kit Illumina Platforms (Roche).
-
bioRxiv - Genomics 2020Quote: ... Entire material of one conversion was equally distributed to a 96-well plate and amplified via PCR using KAPA HiFi Uracil+ Kit (Roche) in a total volume of 16µl ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... cDNA synthesis and PCR amplification were carried out in the same tube using the qScript One-Step SYBR Green qRT-PCR Kit (Quantabio) and a LightCycler480 II (Roche). All reactions were performed in triplicate ...
-
bioRxiv - Microbiology 2019Quote: ... RNA transcripts of the cloned 5’UTRB7 fragments were produced in vitro from the resulting purified PCR products by using the T7 Transcription kit (Roche) and labeled by using the RNA 3’ end biotinylation kit (Pierce) ...
-
bioRxiv - Plant Biology 2019Quote: ... with 340bp insert size according to KAPA Library Preparation Kit with no PCR Library Amplification/Illumina series (Roche-Kapa Biosystems) protocol and sequenced on HiSeq2000 (v4 ...
-
bioRxiv - Plant Biology 2019Quote: ... with 340bp insert size according to KAPA Library Preparation Kit with no PCR Library Amplification/Illumina series (Roche-Kapa Biosystems) protocol and sequenced on HiSeq2000 (v4 ...
-
bioRxiv - Genomics 2021Quote: ... were used to prepare single-end (SE) libraries with an insert size of 300 bp using a PCR-free workflow with the KAPA HyperPrep Kit (Roche) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... were generated cloning each enhancer from the genomic zebrafish DNA DNA using KAPA Long Range HotStart PCR kit (Kapa Biosystems) and cloned into the E1b:GFP:AC-DS vector (102417 Addgene (Chong-Morrison et al. ...
-
bioRxiv - Microbiology 2020Quote: ... gRNA encoding DNA sequences were amplified in a two-step nested PCR using KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems) and sequenced on an Illumina NextSeq (High Output ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...