Labshake search
Citations for Roche :
2051 - 2100 of 8093 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... RT-qPCR was performed on a LightCycler 480 instrument (Roche) using SYBR Green I Master Mix (4887352001 ...
-
ENGRAILED-1 transcription factor has a paracrine neurotrophic activity on adult spinal α-motoneuronsbioRxiv - Neuroscience 2023Quote: ... RT-qPCR was done using SYBR-Green (Roche Applied Science) and a Light Cycler 480 (Roche Applied Science) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR reactions were realized on LightCycler® 480 (Roche) with MESA FAST qPCR MasterMix Plus for SYBR® Assay No ROX (Eurogentec) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR enriched (8-10 cycles) using the KAPA Hyper Library Preparation kit (KAPA Biosystems, #KK8504). eCLIP libraries were prepared as described above according to (Van Nostrand et al. ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was extracted from 106 cells using High Pure PCR Template Preparation Kit (Roche, 11796828001). 150 ng of purified DNA was digested in Reaction Buffer (200 mM sodium acetate [pH 4.5] ...
-
bioRxiv - Microbiology 2022Quote: ... DNA probes were synthesised using the designed primers followed by PCR DIG-probe Synthesis kit (Roche) according to the manufacturer’s instructions in 50μl reaction volumes ...
-
bioRxiv - Microbiology 2021Quote: ... The DIG-labeled probe was synthesized using the PCR DIG probe synthesis kit (11636090910, Roche, Switzerland) and the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... Emulsion PCR was performed using the GS FLX Titanium emPCR Kit Lib-L (Roche Applied Science) to enrich DNA library beads for the 454 GS-junior sequencers ...
-
bioRxiv - Pathology 2021Quote: DNA extraction and PCR were performed using Kapa mouse genotyping kit (Kapa Biosystems, Wilmington, MA, USA) according to the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Biochemistry 2022Quote: DNA from liver and cell pellets was isolated using High Pure PCR Template Preparation Kit (Roche). DNA concentrations were measured by Nanodrop 2000c Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was conducted with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers used for qRT-PCR are listed in Supplementary Table 2 ...
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: ... Probe was generated using the PCR DIG probe synthesis reaction kit (Roche cat# 11636090910, Basel, Switzerland). Tel2 (GAATAATGAGAATTTTCAGGC ...
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... Concentration of the pool was measured with quantitative PCR (KAPA Library Quantification Kit, Roche, Basel, Switzerland). Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The qRT-PCR was performed using KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems) with StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Plant Biology 2023Quote: ... The purified PCR products were prepared for the libraries using the Kapa DNA Hyper Kit (Roche) utilizing indexes from TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... full-length KILR was amplified from T47D cDNA using the KAPA HiFi PCR Kit (Kapa Biosystems) and KCTD1-5 cDNA was synthesized by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μl reactions were prepared for each sublibrary with the KAPA HiFi PCR Kit (Roche, KK2502) containing 0.5 μl of the oligo pool resuspended to 20 ng/μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μl reactions were prepared for each sublibrary with the KAPA HiFi PCR Kit (Roche, KK2502) containing 0.5 μl of the oligo pool resuspended to 20 ng/μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the High Pure PCR Product Purification Kit (Roche Applied Science) [44].
-
bioRxiv - Cancer Biology 2024Quote: ... Whole transcriptome amplification was performed with KAPA HiFi Hotstart Readymix PCR kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (Supplementary Data) ...
-
bioRxiv - Neuroscience 2024Quote: ... Riboprobes were generated by PCR and labelled with the DIG RNA labelling kit from Roche (11175033910). The next day ...
-
bioRxiv - Systems Biology 2020Quote: ... Metagenomes were obtained by pyrosequencing 16S rRNA amplicons on the GS FLX system (Roche). Data were processed by replicating the bioinformatics workflow followed by Amir and colleagues 21 in order to obtain the matrix of the bacterial absolute abundance ...
-
bioRxiv - Microbiology 2020Quote: ... 16S rRNA amplicon cleanup was performed with KAPA Pure Beads (Kapa Biosystems, Indianapolis, IN) at 0.8x concentration according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... and subsequently ligated at 16 °C with 50 U T4 DNA ligase (Roche, #10799009001) in a final reaction volume of 7 ml ...
-
bioRxiv - Immunology 2021Quote: ... concentrations measured in 100 ul of basolateral medium incubated with the reaction mixture of a cytotoxicity detection kit (Sigma-Aldrich, Roche, Saint Louis, MO, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR was performed using KAPAHiFi PCR HotStart Readymix (Roche) with an annealing temperature of 50° and an extension of 15 s for 30 cycles (melting temperature of one of two primers is 47°) ...
-
bioRxiv - Genetics 2019Quote: ... PCR was conducted using FastStart PCR Master Mix (Roche), purified using the QIAquick PCR purification kit (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR was performed using GC-RICH PCR System (Roche). SYNGAP primers (rSG_F ...
-
bioRxiv - Genomics 2021Quote: ... 6μL PCR mix (1x KAPA HiFi PCR buffer(Roche), 0.3mM dNTPs/each(Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The pooled library was cleaned using MO BIO UltraClean® PCR Clean-Up Kit (MO BIO, Carlsbad, CA) and quantified using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing was carried out as detailed in the EMP protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... the samples were incubated in detection buffer containing NBT-BCIP (Roche) at 25 °C for several hours or 4°C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection was conducted with Lumi-Light PLUS Western Blotting Substrate (Roche) and images were obtained with LAS3000 (Fujifilm ...
-
bioRxiv - Developmental Biology 2019Quote: ... and LightCycler DNA Master SYBR Green I detection (Roche, Penzberg, Germany) according to the manufacturers instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... we used a cell death detection ELISA (Roche Molecular Systems, Inc.), which is an analytical quantitative sandwich enzyme immunoassay technique that uses the interaction the mouse monoclonal antibodies with DNA and histone to detect internucleosomal fragmented DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Immunology 2023Quote: ... Antibody detection was further performed using streptavidin–alkaline phosphatase (11089161001, Roche) for 1 hour and then alkaline phosphatase substrate solution containing 4-nitro-phenyl phosphate (N2765-50TAB ...
-
bioRxiv - Genomics 2020Quote: Northern probes were first synthesized using the PCR DIG Probe Synthesis Kit (Roche # 11 636 090 910). The 512 bp frq probe was amplified from wild-type Neurospora genomic DNA with primers ...
-
bioRxiv - Neuroscience 2020Quote: DNA was extracted from mouse ear biopsies using High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The qRT-PCR reactions were done using the LightCycler 480 SYBR green I kit (Roche Cat #04077516001), using the following primers at a concentration of 5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA was isolated from 2.5×107 cells using the High Pure PCR Template Preparation kit (Roche). 1.1 µg DNA was then either treated with 10 U recombinant E ...
-
bioRxiv - Physiology 2019Quote: ... taiwanensis VLB120 was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Upstream (TS1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Amplicons were obtained after PCR amplification using Kapa HiFi HotStart Readymix kit from Kapa Biosystems (Cat# KK2602) according to the supplier’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems). Sequencing libraries were loaded on a NextSeq500 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Southern blot probe for CAG-CATflox-AT2R mice was generated using PCR DIG probe synthesis kit (Roche) with primers GCC GAA TTC GCC GCC ACC ATG AAG GAC AAC TTC AGT TTT GCT GCC and GCA GGT AAT AAA AAA ATA TGC TTG CAA ACA TGT TCA G ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were processed for DNA isolation using the High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...