Labshake search
Citations for Roche :
151 - 200 of 891 citations for Recombinant Human CSF2 Protein non tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... the supernatants containing the His-tagged histones were combined with NiNTA resin (Complete His-Tag purification Resin, Roche) (1mL of Ni-NTA per 1L of bacteria ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 g/ml human transferrin (Roche), 5 ng/ml VEGF (PeproTech 450-32) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 180 μg/ml human transferrin (Roche). Flk-1+ cells were isolated by magnetic cell sorting (MACS ...
-
bioRxiv - Developmental Biology 2021Quote: ... F0425)/500 µg protein with protein A-agarose (Roche). Fished-out FGFR3 protein was eluted and then denatured at 95°C for 10 minutes in NuPAGE LDS sample buffer (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... Amplified libraries were subjected to hybridization with biotinylated oligonucleotide pools that were designed by the HyperDesign Team (Roche) and synthesized by Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was extracted from recombinant clones with the High Pure Isolation kit (Roche) as directed by the manufacturer and sequenced in an ABI PRISM 3100 genetic analyzer (Applied Biosystem ...
-
bioRxiv - Microbiology 2020Quote: ... the column was treated with recombinant DNase I (20 units/100 µL; Roche Diagnostics) for 30 min at 37°C and RNA was eluted in 50 µL nuclease free water ...
-
bioRxiv - Microbiology 2020Quote: ... and ultimately digested with 1.25 µg of recombinant Trypsin (sequencing grade; Roche, Mannheim, Germany) overnight at 37 °C (Sechi and Chait ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd.) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Microbiology 2020Quote: ... the column was treated with recombinant DNase I (20 units/100 μL; Roche Diagnostics) for 30 min at 37°C and RNA was eluted in 50 μL nuclease free water ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.25 mM DTT) supplemented with 0.05 U/µl RNase-free recombinant DNase I (Roche), 0.4 U/µl RNasin (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant cloned from Flavobacterium meningosepticum and expressed in Escherichia coli) was purchased from Roche Diagnostics (Mannheim ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples were DNase-treated by incubating the extracts with DNase I recombinant (Roche) at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... [U-13C]palmitate was first non-covalently conjugated to ultra fatty acid free BSA (Roche) as previously described (Vacanti et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... HA-tagged RIN4a and RIN4b expressed in soybean transgenic roots were detected using monoclonal HA-antibody (Roche Diagnostics, Germany) with or without HRP-conjugate and used in 1:2500 dilution ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified products were subjected to second strand synthesis using 0.3 µM of second strand biotinylated primer and the KAPA Hi-Fi hot start ready mix (KK2601, Roche). The second strand reaction was carried out at 95 °C for 3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... then subject to second-strand synthesis using 1.5 μl biotinylated oligo (10 μM) and 25 μl KAPA Hi-Fi hot start ready mix 2x (KK2601, Roche). Second strand reactions were incubated at 95°C for 3 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... eGFP-tagged readthrough reporter was immunoprecipitated by addition of 10 μg of mouse monoclonal anti-GFP IgG (Roche, cat#11814460001) or normal mouse IgG as a negative control (Proteintech ...
-
Evolutionary repair: changes in multiple functional modules allow meiotic cohesin to support mitosisbioRxiv - Evolutionary Biology 2019Quote: ... Rec8 and Scc1 were all tagged with 3xHA at the C-terminus of coding sequences and anti-HA antibody (3F10, Roche) was used to detect the abundance of kleisin proteins ...
-
bioRxiv - Molecular Biology 2021Quote: Aag2 cells were transfected with a plasmid expressing 3×flag tagged Zuc using X-tremeGENE HP DNA Transfection Reagent (Roche), and fixed 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2021Quote: A 3×flag tagged Zuc expression plasmid was transfected into Aag2 cells using X-tremeGENE HP DNA Transfection Reagent (Roche). Cells were lysed and lysates incubated with M2-Flag beads (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 293T cells (from four confluent T175 flasks per GST-tagged bait) were collected by scraping and lysed with lysis buffer supplemented with protease inhibitor cocktail (EDTA-free, cOmplete, Roche). The lysate was clarified by centrifugation for 5 minutes at 17,000 x g and pre-cleared with 100 μL of Glutathione Sepharose bead slurry per bait ...
-
bioRxiv - Microbiology 2023Quote: ... HA-tagged pUL97 kinase was immuno-precipitated from transfected HEK 293T cells using the rat anti-HA antibody clone 3F10 (Roche). Kinase inhibitors were added to the kinase reactions at final concentrations of 1 μM (CDKIs ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... These DNA molecules were then aligned as the chromium barriers and flow-stretched so that the dig-tagged ends were anchored to chromium pedestals coated with anti-dig antibody (Roche). These DNA molecules were then flow-stretched so that the dig-ends were anchored at chromium pedestals coated with anti-dig antibody (Roche) ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: ... a total of ∼1×107 HEK293T cells stably expressing the GFP-STARD3 or Flag-tagged YWHAH were harvested and lysed using the lysis buffer supplemented with protease inhibitor (Roche). Clarified lysate was mixed with pre-washed 10 𝜇l of GFP-Trap A beads (Chromotec gta-20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were co-transfected with 5 μg of Myc-tagged NAT10 and 5 μg of BRD4 short or long isoform using the Xtremegene 9 DNA transfection reagent (Roche). After overnight incubation ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451) ...
-
bioRxiv - Neuroscience 2023Quote: Cells were lysed in non-denaturing lysis buffer supplemented with EDTA-free protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Physiology 2019Quote: ... Serial dilutions of human genomic DNA (Roche) (final concentrations from 0.5 ng/mL to 5000 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... Human IL-2 (TECIN™ teceleukin, ROCHE, was generously provided by the NCI Biological Resources Branch ...
-
bioRxiv - Molecular Biology 2021Quote: ... and human genomic DNA (Roche Diagnostics, Germany) were used as templates for the experiments in Figure 2 and S1a ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-CD20 human Ab (obinutuzumab, Roche). Relevant negative controls were performed using isotype antibodies and cells incubated with anti-CD20 human and anti-CD20 mouse antibody served as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Microbiology 2020Quote: ... 400 μl sonication solution and 3.8 μg/μl of proteinase K (proK, Recombinant PCR Grade [Roche]) for fraction B2 ...
-
bioRxiv - Microbiology 2022Quote: DNase treatment was performed according to the manufacturer’s protocols (RNase-free DNase I recombinant, Roche, US) for 1 hour ...
-
bioRxiv - Genetics 2021Quote: ... all RNA samples used in this study were treated with recombinant RNase-free DNase I (Roche) (10 U of DNase I per 3 mg of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant RBD007 plasmid was transfected using FuGENE 6 transfection reagents (Roche Applied Science, Indianapolis, IN) into CHO-K1 cells precultured in F-12K medium (American Type Culture Collection ...
-
bioRxiv - Cell Biology 2020Quote: ... Chloroform extracted RNA was treated with RNase free recombinant DNase I (047 716 728 001, Roche) for 1 h at 37°C using 2 units/μg of RNA ...
-
bioRxiv - Bioengineering 2023Quote: ... coli DH10B recombinant strain was extracted using the High Pure Plasmid Purification Kit (Roche, Basel, Switzerland), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The embryos were incubated in 50 μL of recombinant Proteinase K (Roche Holding AG, Basel, Switzerland) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cancer Biology 2021Quote: Total cell lysates from human RMS cell lines and human myoblasts were obtained following lysis in RIPA lysis buffer supplemented with protease inhibitors (Roche). Western blot analysis was performed similar to Ignatius et ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-agarose and protein A-agarose beads were from Roche. GFP-Trap®-A beads were from Chromotek (Planneg-Martinsried ...