Labshake search
Citations for Roche :
101 - 150 of 891 citations for Recombinant Human CSF2 Protein non tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Microbiology 2020Quote: Biotinylated HIV-1 FISH probes were prepared with the Nick Translation Kit (Roche, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Biotinylated RNAs were transcribed in vitro with Biotin-RNA Labeling Mix (Roche, Indianapolis, IN) and purified with quick spin RNA columns (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1.2 μl of KAPA HiFi Non-Hot Start Master Mix (Kapa Biosystems) using 12 amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... and non-fasting glucose concentrations were monitored weekly using Accu-Check glucometer (Roche). Plasma and islet insulin and proinsulin concentrations were measured by commercial ELISA kits (10-1247-01 and 10-1232-01 ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Biophysics 2020Quote: ... fibronectin from human plasma (Roche), the final concentration used for the experiments was 50 μg/ml (containing 2/3 of bovine and 1/3 of human FN) ...
-
bioRxiv - Developmental Biology 2019Quote: ... human holotransferrin 0.6% (Roche, 10652202001); monothioglycerol 0.0039 % (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Human fibronectin (Roche Diagnostics, 11051407001); Puromycin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and human insulin (11376497, Roche) were digested with recombinant WT or protease-dead (cf-E111Q ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The extracted RNA was then treated with DNase I recombinant RNase free (Roche) and the reverse transcription was done using the Super-Script IV (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μg of total RNA was incubated with recombinant DNase I (Roche, 04716728001) for 30 min at 37°C and the reaction was stopped by incubation at 75°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Residual genomic DNA contamination was removed by treatment with recombinant DNAse I (Roche). cDNA was generated using Superscript II reverse transcriptase and Oligo d(T ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant lentiviruses were produced by transfecting HEK293T cells using FuGENE®6 (Roche) with plasmids encoding viral enzymes and envelope proteins essential for packing of viral particles (pRSV-EV ...
-
bioRxiv - Microbiology 2023Quote: ... 1X antibiotic-antimycotic) with 100 U/mL recombinant interleukin (IL)-2 (Roche #11147528001) and activated or frozen in freezing media (90% FBS ...
-
bioRxiv - Microbiology 2023Quote: DNase treatment was performed using recombinant RNase-free DNase I (Roche, Basel, Switzerland) according to the manufacturer’s protocols for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were blocked in 5% non-fat milk or 5% Casein (Roche Diagnostics) in Tris-buffered saline with 0.1% Tween (TBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: Targeted capture was performed using a custom pool of biotinylated capture probes (SeqCap EZ Prime Choice, Roche) targeting 97 genes recurrently mutated in myeloid malignancies and clonal hematopoiesis spanning 347 kb (Table S2) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... His-tagged AtTPL188 (wt and mutants) bacteria pellets were resuspended in buffer A with EDTA-free antiprotease (Roche). The soluble fractions recovered after sonication were passed through a Ni-sepharose (GE Healthcare ...