Labshake search
Citations for Roche :
451 - 500 of 891 citations for Recombinant Human CSF2 Protein non tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Cell Biology 2019Quote: ... protein was isolated from hMPCs with RIPA buffer containing phosphatase (PhosSTOP, Roche) and protease (cOmplete ...
-
bioRxiv - Cell Biology 2020Quote: ... and protein was eluted by cleaving with 20 U/ml thrombin (Roche) in TCB (50 mM Tris ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... resuspended in protein resuspension buffer (2% SDS, 10 mM NaF, 1x Roche cOmplete Mini proteinase inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... Soluble protein was purified using batch/gravity-flow affinity chromatography (cOmplete, Roche). MED1 (50-660 ...
-
bioRxiv - Microbiology 2019Quote: ... Protein was detected by incubation with a solution of NBT/BCIP (Roche) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used for immunoprecipitation were Protein G Agarose beads (Roche, 1124323301) and anti-FLAG (M2 ...
-
bioRxiv - Genomics 2021Quote: ... proteins were visualized using the lumi-light plus western blotting substrate (Roche).
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were immunologically detected by using anti-HA (3F10)-HRP (Roche, Switzerland) or anti-Myc-tag (HRP-DirecT ...
-
bioRxiv - Neuroscience 2020Quote: ... the proteins were transferred onto a PVDF membrane (Roche Diagnostics, Mannheim, Germany). Cofilin1 and phospho-Cofilin1 (Ser3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were lysed and sonicated in RIPA buffer with protein inhibitors (Roche). Protein concentrations were estimated by BCA assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subsequently proteins were digested by addition of proteinase K (Roche #03115852001) at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The relipidated proteins were treated with 1 mM AMPPNP (sodium salt, Roche) for overnight at 4 °C and desalted with a PD-10 column ...
-
bioRxiv - Plant Biology 2022Quote: ... and proteins were eluted by using 0.25 mg/ml HA peptide (Roche). HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immune complexes were captured using 20 µl Protein A agarose beads (Roche, previously saturated with 1 mg/ml BSA and 1mg/ml yeast tRNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and total serum protein (TSP) were determined using kits supplied by Roche Diagnostics and the Roche/Hitachi Analyzer machine at Al-Aulaqi Specialized Medical Laboratory ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were extracted using EB2 supplemented with 1X PhosSTOP (Roche, Indianapolis, IN) and FLAG immunoprecipitation was performed using anti-FLAG M2 agarose (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA-protein complexes were immunoprecipitated using a monoclonal anti-GFP antibody (Roche). Analysis of enrichment of target genes was performed by qPCR using the oligos listed in the Table S2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and proteins were digested with 0.04 mg/mL proteinase K (Roche #03115852001). DNA was recovered using a DNA purification kit (Bioline #52060) ...
-
bioRxiv - Neuroscience 2022Quote: ... protein G-Sepharose Fast Flow and immobilized streptavidin Mutein Matrix from Roche; protein molecular weight standards from Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... proteins were extracted using RIPA (Triton 1%) buffer supplemented with protease (Roche) and phosphatase inhibitors (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... After last wash proteins were cleaved by adding sequencing grade trypsin (Roche) in a 1:100 trypsin:protein ratio ...
-
bioRxiv - Cell Biology 2023Quote: ... Fusion proteins were detected with α-Myc monoclonal antibodies (Roche, Stockholm, Sweden). The following constructs were used ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μL of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were then degraded by addition of 50 µg Proteinase K (Roche) and incubation at 56°C for 90 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and subsequently incubated with 20 μL of protein G-agarose beads (Roche) or protein A-agarose beads (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were suspended in in cOmplete Protease Inhibitor Cocktail (Roche) containing radio-immunoprecipitation assay (RIPA ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell lysates were incubated further with protein G sepharose beads (Roche Applied Bioscience) for 2 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Pull-down was performed with 30 µl protein-G-agarose bead slurry (Roche) for 1 hr at 4°C under gentle agitation ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg of protein lysate was incubated with 1μg anti HA-antibody (Roche) overnight at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Protein blots were probed either directly with a Streptavidin-alkaline phosphatase conjugate (Roche) or with antibodies raised against GFP (Sicgen ...
-
bioRxiv - Plant Biology 2020Quote: ... The immunoprecipitated proteins were detected by Western-blotting using anti-HA antibody (Roche) and anti-Flag antibody (Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... followed by a 2 h incubation with Protein A Agarose beads (Roche, 11719408001) at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and protease and phosphatase inhibitors to isolate insoluble proteins and S7 nuclease (Roche) to release DNA bound proteins ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected with primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:1000 and rabbit α-PfHP1 12 ...
-
bioRxiv - Biochemistry 2021Quote: Protein was collected from cells lysed in RIPA buffer with protease inhibitor (Roche). Protein extracts were passed through a 25g needle to break up DNA and subsequently quantified using BCA assay ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were electroblotted to PVDF membrane and probed with specific antibodies: αHA (Roche), αGFP (Milteny Biotech) ...