Labshake search
Citations for Roche :
1701 - 1750 of 7604 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR was run using SYBR green (Roche) on a QuantStudio 6 (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using SYBR Green (Roche) and a QuantStudio 7 Flex (Life Technology ...
-
bioRxiv - Plant Biology 2019Quote: ... GUN1 protein was expressed in RTS ProteoMaster (Roche). Full-length GUN1 cDNA and N-terminal truncated versions as EcoRI-SalI PCR fragments were ligated into pET48b (Novagen ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-HA (rt, 1:1000, Roche, clone 3F10), anti-CNG channel (ms ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was run on Lightcycler 480 (Roche) using SYBR Green 1 Master Kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... or RevertAid RT (Thermo) with random hexamers (Roche). qPCR was performed with the SensiFAST No-ROX Probe Master Mix (Bioline ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were performed using 50 ng of metagenomic DNA per sample using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 µL final volume and containing 4 µL of 5X Kapa HiFi Buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... The cDNA was diluted 20-fold and used for qRT-PCR employing a LightCycler® 480 SYBR Green 1 Master PCR labelling kit (Roche Applied Sciences) and RotorGene 3000 Real time PCR machine (Corbett Research ...
-
bioRxiv - Zoology 2019Quote: ... PCR products were visualized on a 1.5% agarose gel and cleaned using the HiPure PCR product Cleanup kit (Roche Life Sciences, Indianapolis, IN) and sent for sequencing at Macrogen USA (Rockville ...
-
bioRxiv - Synthetic Biology 2019Quote: ... purified by gel electrophoresis and extracted from the gel via a commercial kit (HighPure PCR Product Purification Kit, Roche, DE). Sample preparation (Illumina TruSeq amplicon library ...
-
bioRxiv - Immunology 2021Quote: ... Each cDNA sample was ten times diluted and amplified using KAPA SYBR® FAST qPCR Kit (Kapa Biosystems) on the CFX Connect™ Real-Time PCR detection System (Bio-Rad) ...
-
bioRxiv - Systems Biology 2019Quote: mRNA was extracted at the indicated time points using the High Pure RNA Isolation kit (Roche, Mannheim, Germany). cDNA was generated using M-MuLV reverse transcriptase (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs diluted 2 times were examined by qPCR with the KAPA SYBR Fast qPCR Kit (Kapa Biosystems, K4602) using specific primers for β-actin ...
-
bioRxiv - Bioengineering 2021Quote: Total RNA was extracted at different time-points of cerebellar differentiation using High Pure RNA Isolation Kit (Roche) and converted into complementary cDNA with Transcriptor High Fidelity cDNA Synthesis Kit (Roche) ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... Custom DIG-labeled probes were generated using PCR DIG Probe Synthesis Kit (Roche #11636090910) and blots were hybridized for 16 hours at 48°C with a final concentration of 25ng/ml probe in 10ml DIG EasyHyb buffer rolling in hybridization tubes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each PCR product was ligated into Eam1105I-digested pJC53.2 vector (Quick Ligation Kit, Roche) for use in ISH and RNAi experiments (Collins et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and libraries were quantified by Q-PCR using the Kapa Library Quantification Kit (Roche). RNA-seq experiments were performed on an Illumina HiSeq3000 using a paired-end read length of 2×150 pb.
-
bioRxiv - Molecular Biology 2021Quote: ... QHR-4C libraries were purified by the High-Pure PCR Product Purification kit (Roche).
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed with the SYBR Green I Master kit (Roche Applied Science) in a LightCycler 480 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ligation products were amplified with 9 PCR cycles using KAPA Hifi kit (Roche, P5 universal primer and P7 indexed primer D7XX) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes were prepared using the PCR DIG Probe Synthesis Kit (Roche, Basel, Switzerland, 11636090910).
-
bioRxiv - Molecular Biology 2022Quote: ... Probes were prepared using a PCR DIG Probe Synthesis Kit (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Roche, 11796828001) and the PCR performed using the ALLin Red Taq MasterMix (highQu ...
-
bioRxiv - Neuroscience 2020Quote: DIG-labeled DNA probes were synthesized using PCR DIG Probe Synthesis Kit (Roche #11636090910). Primers were designed to target either external (676 bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... The ligated samples were purified using the High-Pure PCR Product Purification kit (Roche). The 4C-seq libraries were generated by PCR using a high-fidelity DNA polymerase (Vazyme) ...
-
bioRxiv - Genetics 2019Quote: ... We purified the DNA with High-pure PCR Product Purification Kit (Roche, Cat#11732676001) and performed the 2nd round of PCR to attach to the libraries adaptor and index sequences for the NGS analysis for 8 cycles again with Tks Gflex™ DNA Polymerase (Takara ...
-
bioRxiv - Genetics 2019Quote: ... The DNA was purified with High-pure PCR Product Purification Kit (Roche, Cat#11732676001). The final libraries were pooled and sequenced with the HiSeq2500 system as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... and qRT-PCR reaction was performed with KAPA SYBR FAST qPCR kit (KAPA Biosystems). At least triplicate samples were assessed for each gene of interest ...
-
bioRxiv - Systems Biology 2019Quote: ... Probes were prepared using the PCR DIG Probe Synthesis Kit (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using the Kapa Library Amplification Kit (Kapa Biosystems, Massachusetts, USA) and BSA 400ng/μL ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and chromatin quality analysed using EtBr agarose gel electrophoresis (1.3 % Biozym ME Agarose ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and analysed using ethidium bromide (EtBr ...
-
bioRxiv - Biochemistry 2021Quote: ... and libraries were quantified by Q-PCR using the Kapa Library Quantification Kit (Roche). RNA-seq experiments were performed on an Illumina HiSeq3000 using a paired-end read length of 2x150 pb ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a second purification with High Pure PCR Product Purification Kit (Roche, Germany). The TOPO TA cloning kit (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and tibiotarsal joint using Roche High Pure PCR template preparation kit (Roche, Indianapolis, IN) as previously described [62,63,90] ...
-
bioRxiv - Microbiology 2021Quote: ... Concentration of the pool was monitored with quantitative PCR (KAPA Library Quantification Kit, Roche). Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... DIG-labeled LINE DNA probe was prepared by PCR DIG Probe synthesis kit (Roche). Hybridization and autoradiography were performed according to the DIG Application Manual (Roche).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted using a Tissue Lysis Buffer and PCR template preparation kit (Roche).
-
bioRxiv - Immunology 2022Quote: ... Library molarity was measured via quantitative PCR with the KAPA Library Quantification Kit (Roche) on a BioRad CFX Connect thermal cycler ...
-
bioRxiv - Microbiology 2022Quote: ... The probes were then purified using a PCR clean up kit (Roche Applied Science). The oligonucleotides had been ordered with 5’ biotinylated ends allowing for subsequent complex detection ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR was performed using the LightCycler480 SYBRGreen I Master1 kit (Roche Life Science) and the CFX Connect Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... We re-circularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Using a two-step nested PCR with KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems), sgRNA expression cassettes were amplified ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions were performed by KAPA HiFi HotStart ReadyMix kit (Roche, Cat# KK2601) and subsequently assembled by yeast [Saccharomyces cerevisiae strain EBY100 (ATCC ...
-
bioRxiv - Plant Biology 2023Quote: ... The 840 bp HPT probe was synthesized by PCR DIG Probe Synthesis Kit (Roche) using primers HPT-DIG-F and HPT-DIG-R (table S1) ...
-
bioRxiv - Genomics 2024Quote: ... adapter ligation and PCR amplification was performed using the Kapa Hyper Prep kit (Roche). Beads were resuspended in 60 µL of a cocktail containing 50 µL H2O ...
-
bioRxiv - Molecular Biology 2024Quote: Liver genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Roche), followed by RNAse A treatment ...