Labshake search
Citations for Roche :
1601 - 1650 of 7604 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... cytotoxicity was determined based on the release of lactate dehydrogenase (LDH) into the co-culture supernatant measured by Cytotoxicity Detection Kit (Roche) and using a Synergy 2 Multi-Mode Microplate Reader (Biotek ...
-
bioRxiv - Developmental Biology 2023Quote: Apoptotic cells present in gonadal histological preparations were revealed by the terminal deoxyribonucleotidyl transferase (TDT)-mediated dUTP-digoxigenin nick end labelling (TUNEL) assay using the Fluorescent In Situ Cell Death Detection Kit (Roche ref ...
-
bioRxiv - Developmental Biology 2022Quote: ... TUNEL staining on 60 dpf paraffin embedded testes sections were performed using a fluorescein In Situ Cell Death Detection Kit (11684795910, Roche). Immunolabelling with Vasa antibody was done before the TUNEL staining ...
-
bioRxiv - Developmental Biology 2023Quote: ... Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was done following manufacturer’ s instruction (In Situ cell Death Detection Kit TMR red, Roche).
-
bioRxiv - Immunology 2023Quote: ... Cell death was quantified using media from experimental endpoints (in phenol redLfree DMEM) to measure the percentage of released lactate dehydrogenase activity (LDH) using Cytotoxicity Detection Kit (Roche).
-
bioRxiv - Immunology 2023Quote: ... Lactate dehydrogenase (LDH) in the supernatants from either cell type was quantified using the LDH Cytotoxicity Detection kit (TaKaRa or Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay was performed using the In Situ Cell Death Detection Kit (11684795910, Roche) and ...
-
bioRxiv - Neuroscience 2023Quote: The TUNEL assay was caried out using the In Situ Cell Death Detection TMR rot kit (Roche, cat. no. 12156792910) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... or Ultra View Universal Alkaline Phosphatase Red Detection Kit (yielding pink signals) using standard machine settings (all solutions were from Ventana, Roche). Counterstaining (light blue background ...
-
bioRxiv - Plant Biology 2024Quote: ... Post-hybridization washes and immuno-chemiluminescent detection of the bound probe were conducted following the instructions provided in the DIG Northern Starter Kit manual (Roche). To assess siRNA size via northern blot analysis ...
-
bioRxiv - Cancer Biology 2024Quote: The Terminal dUTP Nick End Labeling (TUNEL) and In Situ Cell Death Detection Kits (TMR Red #12156792910; Roche Applied Science) were used to examine apoptosis ...
-
bioRxiv - Microbiology 2019Quote: ... To determine the viral load by RT-qPCR RNA was extracted from apical washes (High Pure Viral RNA kit, Roche). cDNA was prepared using 10 µL RNA (High Capacity cDNA Reverse Transcription kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... The RNA concentration was measured by a spectrophotometer (NanDrop1000; Thermo) followed by a reverse transcription process using PrimeScript RT reagent kit (Roche). Real time PCR analysis was performed using SYBR green mix (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNAse was inactivated with 1 µl of Stop Solution at 65°C for 10 min and RT was performed using Transcriptor First Strand cDNA Synthesis Kit (Ref. 04 897 030 001, Roche) in a final volume of 20 µl ...
-
bioRxiv - Microbiology 2020Quote: ... Library concentrations for pooling of barcoded samples was assessed by RT-qPCR with a KAPA Library Quantification kit (KAPA Biosystems) as recommended for high sensitivity ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR analysis of cytokine related porcine gene expression was performed using the KAPA SYBR-FAST qPCR Kit (KAPA Biosystems), using the primers shown in Table 1 ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using the LightCycler 480 Probe Master Kit and the LightCycler 480 II system (Roche Applied Science) as described previously92 ...
-
bioRxiv - Microbiology 2021Quote: ... Library concentration for pooling of barcoded samples was assessed by RT-qPCR with a KAPA Library Quantification kit (KAPA Biosystems) as recommended for high sensitivity ...
-
bioRxiv - Genomics 2021Quote: ... We made Lhk and CK2ßtes-Y probes using PCR Nick Translation kits (Roche) and ordered oligo probes from IDT ...
-
bioRxiv - Cancer Biology 2021Quote: ... Q-PCR was performed using Lightcycler 480 SYBR Green 1 Master Kit (Roche). PCR amplification was performed as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were quantified by qRT-PCR using a commercially available kit (KAPA Biosystems) and insert size distribution determined with the LabChip GX ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reactions were purified with the High Pure PCR product purification kit (Roche) and digested with SacI and XbaI enzymes in M buffer (TaKaRa) ...
-
bioRxiv - Cancer Biology 2019Quote: ... QRT-PCR reactions were carried out with a SYBR Green kit (Kapa Biosystems) on a CFX96 qRT-PCR machine (BioRad) ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplifications were performed using the Absolute Blue SYBR green fluorescein kit (Roche Molecular Biochemicals ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting amplicons were purified using High Pure PCR product purification kit (Roche) and shipped to Macrogen Europe B.V ...
-
bioRxiv - Microbiology 2019Quote: Bacterial DNA was extracted with a High Pure PCR Template Preparation kit (Roche Diagnostics Ltd ...
-
bioRxiv - Systems Biology 2022Quote: ... Linear DNA fragments were amplified using high-fidelity PCR kits from Kapa Biosystems sourced from Millipore Sigma (Burlington ...
-
bioRxiv - Neuroscience 2022Quote: ... sexed and genotyped (Kapa2G Robust HotStart PCR Kit, Kapa Biosystems; Hoffman La Roche) one week after birth ...
-
bioRxiv - Neuroscience 2022Quote: ... sexed and genotyped (Kapa2G Robust HotStart PCR Kit, Kapa Biosystems; Hoffman La Roche) one week after birth ...
-
bioRxiv - Genetics 2022Quote: ... Sperm DNA was extracted using the High Pure PCR Template Preparation Kit (Roche) modifying the first step of the protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... subsequently indexed with Nextera adapter sequences using the KAPA2G Robust PCR Kit (Roche) and purified using the PureLink PCR Purification Kit ...
-
bioRxiv - Genomics 2019Quote: ... WGS libraries were prepared according to the KAPA HyperPrep PCR-free Kit (Roche). Illumina NovaSeq S2 150 bp paired-end sequencing was performed to achieve 40X genome coverage.
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... KAPA Taq PCR kit was used according to the manufacturer’s protocol (Kapa Biosystems).
-
bioRxiv - Genetics 2020Quote: ... or ear notch biopsies using the High Pure PCR Template Preparation Kit (Roche), KAPA Express Extract kit (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and purified using a high pure PCR product purification kit (Roche, No. 11732668001). The DNA blots were prehybridized at 42°C for 1 h in DIG easy hyb granule and then hybridized to denatured DIG-labeled probes for 20 h ...
-
bioRxiv - Immunology 2020Quote: ... Site-directed mutagenesis was performed using the KAPA Hifi PCR kits (KAPA Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DNA sequencing libraries were prepared using the PCR-free KAPA HyperPrep Kit (Roche). Libraries were sequenced on an Illumina NextSeq 500 and the quality of the raw sequencing reads was analysed with FastQC (version 0.11.4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Microbiology 2023Quote: ... and PCR products were purified using the DNeasy blood and tissue kit (Roche), the High Pure Plasmid Isolation kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... We recircularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was amplified using KAPA HiFi HotStart PCR kit (Kapa Biosystems, KK2501) according to the manufacturer’s guidelines and specific primers flanking the CRISPR cut site (with the CRISPR cut site off center ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was purified using a High Pure PCR Template Preparation Kit (Roche, 11796828001) and q-PCR was performed as describe above ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the High Pure Purification Kit (Roche Applied Science). The oligonucleotides used to amplify and sequence the different hit-related genes are listed in Table S4.
-
bioRxiv - Evolutionary Biology 2023Quote: Long-range PCR was conducted using a KAPA LongRange HotStart Kit (KAPA Biosystems) in 25 µl volumes with 24 µl Master-mix (ultra-pure MilliQ water ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...