Labshake search
Citations for Roche :
1551 - 1600 of 7604 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) followed by size selection from 1.5kb to 3.5kb with a BluePippin system (Sage Science ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... the small fragments from the cDNA amplification are purified and the library is barcoded and amplified using PCR with the KAPA high fidelity PCR kit(KAPA Biosystems). After all libraries are ready their quality and size are measured using the bioanalyzer before being sequenced on a NEXTseq (Illumina).
-
bioRxiv - Microbiology 2021Quote: The full-length hAce2 gene was PCR-amplified from Mammalian Gene Collection cDNA clone (clone number MGC:47598) using a Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward ...
-
bioRxiv - Microbiology 2021Quote: ... the SARS-CoV-2 Spike gene with a 54-nucleotide deletion at the C-terminus was PCR-amplified from synthetic DNA (provided by Alex Ma, Academia Sinica, Taiwan) using the Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward ...
-
bioRxiv - Genomics 2020Quote: ... a total of 1.0 μg of extracted DNA was used as the starting material for PCR-free library construction (KAPA HyperPrep PCR-Free Library Prep kit; Roche, #KK8505); libraries were then mechanically sheared (Covaris microtube system ...
-
bioRxiv - Cancer Biology 2022Quote: ... We next amplified full-length 1.7kb NT5C2 DNA insert by PCR using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, #KK2601) and the following primers ...
-
bioRxiv - Neuroscience 2023Quote: A total of 1.0 µg of extracted DNA was used for PCR-free library construction using the KAPA HyperPrep PCR-Free Library Prep kit (Roche, KK8505). Mechanical shearing using the Covaris microtube system (Covaris ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Systems Biology 2021Quote: ... Real-time PCR analysis was performed using the LightCycler 480 SYBR Green I Master MIX and LightCycler 96 instrument from Roche (Basel, Switzerland), according to the manufacturer’s protocol with a final individual primer concentration of 0.5 μM ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed on cDNAs in a final volume of 10 µL using SYBR Green I master mix (Roche Life Science) and primers for AtCLCa gene ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... were performed with the Ventana Bench-Mark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For α-Syn ...
-
bioRxiv - Developmental Biology 2020Quote: ... gbx1 and pax6a digoxigenin and FITC antisense probes were generated from linearized plasmids using an RNA labelling and detection kit (Roche)87 ...
-
bioRxiv - Neuroscience 2021Quote: ... and then washed in PBS buffer before incubation with terminal deoxynucleotide transferase (In Situ Cell Death Detection kit; Roche, Switzerland) for 1 h at 37 °C in a solution containing TMR red dUTP ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... The cytotoxic potential of the samples was determined from THP1-cell supernatants after 3 hours by using the Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2019Quote: TUNEL assay for scoring apoptotic cells was performed using In situ cell death detection kit fluorescein (Roche, Catalog No.11684795910), as per manufacturer’s protocol.
-
bioRxiv - Immunology 2019Quote: PFA fixed zebrafish larvae were used in combination with the In situ Cell Death Detection Kit (TMR and Fluorescein) (Roche). After O/N fixation larvae were washed and permeabilized for 45 min at 37°C using Proteinase K ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... subtilis strains at the different time points were evaluated via terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) using the In-Situ Cell Death Detection Kit with fluorescein (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... TUNEL staining was performed prior to secondary antibody incubation using the Biotin-based in situ cell death detection kit (Roche) and following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... TUNEL staining was performed on testis sections according to the instructions provided with the cell death detection kit (11684795910, Roche). To reduce experimental variations ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then treated with the TUNEL reaction mixture according to the protocol (In situ Cell Death detection Kit, TMR red; Roche) and incubated for 1 h at 37°C in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... the probes were detected with anti-digoxigenin and anti-fluorescein antibodies conjugated with alkaline phosphatase (AP) and horseradish peroxidase (HRP) using AP detection kit (Roche) and tyramide signal amplification (TSA ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA was subjected to pre-hybridization and hybridization using a DIG High Prime DNA labeling and detection starter kit II (Roche) according to the manufacturer’s instructions with a DIG-labeled probe of ∼100-200 bp annealing in the targeted gene (for primer sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAB staining was performed using a Ventana Ultraview DAB detection kit in a Ventana BenchMark XT processor (Ventana Medical Systems, a division of Roche). In addition ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were incubated with 50 μl mix of 5 μl enzyme and 45 μl labeling solution (TUNEL In situ Cell Death Detection Kit, TMR Red’ from Roche) for 1.5 h at 37°C in a dark humid chamber ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Detection of apoptotic cells in tissue sections was performed by the TUNEL assay with the In-Situ Cell Death Detection Kit (TMR red, Roche), according to the protocol described previously22 ...
-
bioRxiv - Developmental Biology 2022Quote: ... TUNEL staining was performed using ApopTag Red In Situ Apoptosis Detection Kit (S7100, MerckMillipore) combined with peroxidase (POD) coupled anti-DIG antibody (1/200, #11207733910, Roche) followed by tyramide-based amplification61.
-
bioRxiv - Molecular Biology 2022Quote: Cytotoxicity was determined as lactate dehydrogenase (LDH) activity in cultured supernatants using a cytotoxicity detection kit (#11644793001; Roche, Mannheim, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability analysis by lactate dehydrogenase (LDH) release assay was performed with the Cytotoxicity Detection Kit (LDH) (Roche, Mannheim, Germany) and has also been described 23,31.
-
bioRxiv - Physiology 2019Quote: ... sections were incubated for 1 hrs at 37°C in the dark with the in situ Cell Death Detection Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Labelling efficiencies were tested by dot blotting with anti-digoxigenin alkaline phosphatase conjugate and CSPD chemiluminescence substrate for alkaline phosphatase from DIG High Prime DNA Labelling and Detection Starter Kit II (Roche) according to the manufacturer`s protocol ...
-
bioRxiv - Physiology 2019Quote: ... TUNEL staining was conducted following manufacturer’s protocol (In Situ Cell Death Detection Kit, Version 17, Roche Diagnistics GmbH, Mannheim, Germany). Briefly ...
-
bioRxiv - Genomics 2020Quote: ... These DNA fragments were labeled with digoxigenin (DIG) using a DIG High Prime DNA Labeling and Detection Starter Kit II (Roche), and signals were detected according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... TUNEL assays were performed on sectioned tissue using the TMR red In Situ Cell Death Detection Kit (Roche, Basel, Switzerland), following the manufacturer protocol for labeling of cryopreserved tissues ...
-
bioRxiv - Immunology 2021Quote: ... cell nuclei with DNA strand breaks at the early stage of apoptosis were labeled using fluorescein-dUTP in the TUNEL reaction (In Situ Cell Death Detection Kit; Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Immunostaining was performed by using 1:500 diluted rabbit polyclonal antibodies against ferroportin (49) and an appropriate detection kit (Omnimap rabbit polyclonal HRP, #760-4311 and ChromoMap-DAB #760-159; Roche). Negative controls were performed by the omission of the primary antibody ...
-
bioRxiv - Molecular Biology 2022Quote: ... The blots were hybridized with the MVC VP2 genome probe using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed using the In Situ Cell Death Detection Kit (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and Lactate dehydrogenase (LDH) assay kit (LDH Cytotoxicity Detection KitPLUS) were obtained from Roche (Germany). MG-63 cell line (National Cell Bank of Iran (NCBI) ...
-
bioRxiv - Plant Biology 2022Quote: ... The RNA level was detected using the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Cat. 11585614910).
-
bioRxiv - Cancer Biology 2022Quote: ... In all available cases staining was performed on the Benchmark ultra-automated Stainer (Ventana) using diamino-benzidine as chromogen (DAB detection kit; Ventana, Roche), and anti-AGR2 monoclonal antibody (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... and visualized with anti-DIG-AP antibody according to the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche) instructions on a Chemidoc MP.
-
bioRxiv - Microbiology 2023Quote: ... and the membrane was treated with the DIG-High Prime DNA Labeling and Detection Starter kit II (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Heart sections (described above) were used for TUNEL assays using the in situ cell death detection kit (Cat No. 11684817910, Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Apoptotic cells were identified by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) staining using the In Situ Cell Death Detection Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Apoptotic cell death was assessed as formation of fragmented nucleosomes using the Cell Death Detection ELISAPlus kit (Roche Applied Science) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... lactate dehydrogenase (LDH) was measured in supernatants collected at 48 hours post transfection using cytotoxicity detection kit PLUS Assay (CYTODET-RO, Roche) according to manufacturer’s instructions and plates were read at 490 nm.
-
bioRxiv - Developmental Biology 2023Quote: Apoptotic cells present in gonadal histological preparations were revealed by the terminal deoxyribonucleotidyl transferase (TDT)-mediated dUTP-digoxigenin nick end labelling (TUNEL) assay using the Fluorescent In Situ Cell Death Detection Kit (Roche ref ...