Labshake search
Citations for Roche :
1651 - 1700 of 8155 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... brain from transgenic mice expressing different PrP deletion mutants was homogenized in 10 volumes of lysis buffer (50 mM Tris-HCl pH 8, 0.5% Na deoxycholate, and 0.5% Igepal, protease inhibitors (complete Mini, Roche) using TissueLyser LT for 5 min for 2 cycles ...
-
bioRxiv - Microbiology 2020Quote: RNA of high quality (RINe>8) was prepared for mRNA-sequencing using the KAPA mRNA HyperPrep kit (Roche). Libraries were quantified using a High Sensitivity D1000 ScreenTape (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... and chloride [Cl-] concentrations were determined using an Ion Selective Electrode (Hitachi Modular P+ISE. Roche 8 Diagnostic). Plasma osmolality was analyzed by vapor pressure osmometry (VAPRO 5520 ...
-
bioRxiv - Molecular Biology 2021Quote: Protein lysates were prepared from snap-frozen dorsal skin with urea buffer (8 M Urea, 40 mM Tris-HCl, 2.5 mM EDTA, pH 8.0) containing phosphatase (PhosSTOP, Roche) and protease inhibitors (cOmplete Protease Inhibitor Cocktail Tablet EDTA-free ...
-
bioRxiv - Cell Biology 2020Quote: ... This was followed by 8 min of perfusion with digestion buffer (4mg/mL trypsin, 5mg/mL liberase (Roche) and 0.3mM CaCl2) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were lysed with Cell Lysis Buffer (10mM Tris-Cl pH 8, 10mM NaCl, 0.5% NP40, 1xPIC (Roche)) followed by mechanical shearing for 10minutes on ice ...
-
bioRxiv - Molecular Biology 2022Quote: Pelleted cells were lysed in 500 μl 8 M urea (pH 8.0) with 0.2% Rapidgest (Waters) and protease inhibitors (Roche) using three 20-s sonication pulses in a VialTweeter (DrHielscher) ...
-
bioRxiv - Cell Biology 2022Quote: ... the whole-cell extracts and immunoprecipitates were subjected to western blotting using monoclonal anti-GFP (JL-8, Roche), Flag-M2 monoclonal antibody (Sigma-Aldrich) ...
-
LptM promotes oxidative maturation of the lipopolysaccharide translocon by substrate binding mimicrybioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 20 mM Tris-HCl pH 8 containing a EDTA-free protease inhibitor cocktail (Roche). For the purification of protein samples that had to be analyzed both by reducing and non-reducing SDS-PAGE ...
-
bioRxiv - Neuroscience 2023Quote: ... and with palindromic forked adapters using unique 8-base index sequences embedded within the adapter (purchased from Roche). The libraries are then amplified by 10 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... pH 8) supplemented with 0.2 mg/mL Lysozyme and EDTA free protease inhibitor cocktail (cOmplete, Roche, Basel, Switzerland) and incubated for 30 min on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were lysed with 4% SDS lysis buffer (4% SDS, 150 mM NaCl, 50 mM triethanolamine pH 7.4, Roche protease inhibitor, benzonase). Protein concentrations were determined by the BCA assay (Pierce) ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 cOmplete EDTA-free Protease Inhibitor Cocktail tablets (Roche), 500 U benzonase ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 minutes and Bluing reagent (Roche #760-2037) for 4 minutes.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mL of Red Blood Cell Lysis Buffer (Roche) were added before being gently rocked for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 μL of 20x PhosStop® phosphatase inhibitors (Roche), 4 μL of 20x cOmplete® protease inhibitors (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 μL of 20x cOmplete® protease inhibitors (Roche) and 1,6 μL of 1 M DTT ...
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.4%) + Proteinase-K 4 mg/ml (Roche, 3115887001) and incubated for 2h at 55°C ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Molecular Biology 2019Quote: ... 250 mM sucrose, 5 mM MgCl2, 1 mM EGTA, 0.05% Tween-20, 0.5 mM DTT, 1x protease inhibitors [Roche], 0.4 u/μl RNase inhibitor). The nuclei or permeabilized cells were flash-frozen and stored at −80°C (10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... along with the appropriate antibody (mouse HA 12CA5, 7.5 μl 0.4 mg/ml, Roche; mouse M2 FLAG, 5 μl 1 mg/ml, Sigma), before incubating at 4 °C on a rotating wheel at 14 rpm for 15-18 h ...
-
bioRxiv - Neuroscience 2022Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... ESCs cells and neurospheres were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete™ Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 5 mM EDTA, 50 mM NaF, 1 mM PMSF supplemented with Roche 1X Halt Protease inhibitor cocktail), incubated for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested and lysed using immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Approximately 1.5 mg of lysate from each sample was incubated with brachyury antibody at 4°C for 4 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pooled together and resuspended in 1.5 mL immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Cells were then incubated for 30 minutes on ice prior to centrifugation at high speed (15,000 rpm ...
-
bioRxiv - Immunology 2020Quote: ... at 37° C 5% CO2 in 96 well plates in the presence of IL2 (GIBCO 100 IU/mL or Roche 1 ng/mL). Additional conditions included 1 ng/mL TGFβ (GIBCO) ...
-
bioRxiv - Biochemistry 2023Quote: ... then lysed in ice-cold NP-40 lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol, Roche cOmplete protease inhibitor cocktail) by trituration followed by incubation on ice for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...