Labshake search
Citations for Roche :
1601 - 1650 of 7954 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 50 µl of the post-nuclear supernatant was saved as the input lysate and 450 µl was incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Neuroscience 2020Quote: ... nt 1280-1350 from sequence NM_008553 detected with the mASCL1 probe (Universal Probe Library probe #74, Roche, Cat.No. 04688970001; 5′-(Fam)-GGCAGCAG-(Dark Quencher)-3′) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Telomeric repeats were probed by incubating the membrane with telomeric probe containing digoxigenin (5’CCCTAACCCTAACCCTAACCCTAA-DIG; Integrated DNA Technologies, Coralville, IA; Table S1) overnight at 42°C DIG Easy Hyb™ buffer (Roche). Blots were washed in 2X saline-sodium citrate (SSC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of cDNA were used as a template in a 5- l reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Bacteria were pelleted and resuspended in lysis buffer (30 mM Tris pH 7.5, 450 mM NaCl, 5 mM β-mercaptoethanol, complete™ EDTA-free Protease Inhibitor Cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2019Quote: ... microtubules were treated with 200 μg/mL subtilisin for 45 min at 303 K as described previously.28 Proteolysis was stopped with the addition of 5 mM PMSF (Roche Diagnostics). Subtilisin-treated microtubules were spun at 100,000xg for 30 min at 298 K and were resuspended in reaction buffer at 5 mM MgCl2 ...
-
bioRxiv - Genomics 2019Quote: ... after cells were lysed with Farnham Lysis Buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5% IGEPAL, Roche Protease Inhibitor Cocktail), and nuclei were resuspended in RIPA buffer (1x PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... cells were incubated for 48 h at 37°C in 5% CO2, harvested and lysed using M-PER Mammalian Protein Extraction Reagent (Thermo Scientific, 78501) (with 1X Roche Complete Protease Inhibitor and 100 mM NaCl) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Quantitative Real-time PCR reactions were prepared manually in a total volume of 10 µl by mixing 5 µl 2x KAPA SYBR FAST ABI Prism master mix (KAPA Biosystems), 0.2 µl forward and reverse primer mix (10 µM each primer) ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). Human cells from differentiation experiments were also lysed in 300 µl Tri-Reagent for 5 minutes at RT mechanically dissociated/lysed using a sterile scraper ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Plant Biology 2022Quote: ... RT was performed with 5 µg of total mRNA using Transcriptor Reverse Transcriptase and oligo (dT)15 primer (Roche, Mannheim, Germany). QRT-PCR was run on a LightCycler 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... The tissue was then washed with PBT extensively (10 times or more for 5 minutes) before development with BM-purple (1ml per well, Roche Diagnostics). Time of development was approximately 20 minutes at room temperature to 24 hours at 4°C depending on the probe ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 ml of digestion buffer containing collagenase D (2mg/ml, Roche #11088858001) and DNase (0.125 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue sections were equilibrated in hybridization solution (40 mL of prehybridization solution, 1.6 mL of 5 mg/mL, and 25 mg Roche yeast RNA) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... We equilibrated the sections in hybridization solution (50 mL of prehyb solution, 1.6 ml of 5 mg/ml, and 25 mg Roche yeast RNA) for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 min at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl from the partially amplified barcoded fragments was subjected to SYBR Green qPCR in a LightCycler 480 System (Roche, Germany) using the FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... indexes and sequencing sequences) was performed on 5 µl of purified first step PCR products using Expand™ Long Template PCR System (Roche) with the following thermocycling program ...
-
bioRxiv - Microbiology 2023Quote: ... beads with protein were subjected to overnight digestion by adding 100 µl 5 ng/µl sequencing grade trypsin (Roche Diagnostic GmbH) in ammonium bicarbonate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 mM KCl, 5 mM MgCl2, 0.05% NP-40, EDTA-free cOmplete mini protease inhibitor [Roche, 11836153001], PhosSTOP [Roche, PHOSS-RO]). If indicated ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Microbiology 2024Quote: ... cDNAs were diluted to 1 ng/ µL and used for qPCR analysis in a 10 µL reaction mix containing 5 µL of LightCycler® 480 SYBR Green I Master mix (Roche), 300 nM of each primer ...
-
bioRxiv - Biochemistry 2023Quote: ... The S100 extract was eluted from DEAE resin with 5 ml of S100 Elution Buffer (250 mM KHPO4 (pH 6.5),1x Mini protease inhibitor cocktail tablet (Roche, Basel, Switzerland)) and aliquoted and flash-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). The cell suspension was treated with a Sonopuls GM200 sonicator (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... crosslinked chromatin was resuspended in 1 mL Farnham Lysis Buffer (FLB; 5 mM HEPES pH 8.0, 85 mM KCl, 0.5% NP-40/IGEPAL, Roche Protease Inhibitor Cocktail), centrifuged ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were washed and lysed in 2 mL of lysis buffer (containing in mM: 50 Tris pH 7.2, 5 EDTA, 150 NaCl, 10 NEM, Protease Inhibitor Cocktail (Roche, Basel, Switzerland), 2 PMSF ...
-
bioRxiv - Plant Biology 2019Quote: ... The fine powder was resuspended with the extraction buffer (50 mm Tris, pH 8, 8 M urea, and 0.5% SDS) supplemented with protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany), and homogenized with a Dounce homogenizer ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell pellets were resuspended in approximately five volumes of lysis buffer (50 mM NaH2PO4 pH 8, 1 M NaCl, 10 mM Imidazole, 2 mM PMSF and protease inhibitor cocktail (Roche #4693132001). Cells were lysed by sonication on ice for 12 x 30 seconds at 30 W with one minute on ice in between ...
-
bioRxiv - Neuroscience 2019Quote: ... DRGs were dissected out from 8-week old adult mice and incubated with collagenase A (1 mg/ml; Roche, Basel, Switzerland) for 90 minutes and then with 1X TrypLE (Life Technologies ...
-
bioRxiv - Physiology 2022Quote: ... 2 mM EDTA, 20 mM Tris pH 8, 150 mM NaCl, 1 mM PMSF, 1X cOmplete™ Protease Inhibitor Cocktail, Roche) was added to the fragmented chromatin ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were lysed in SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8) supplemented with Proteinase Inhibitor Cocktail (Roche, 11697498001) and chromatin was sonicated using the Bioruptor pico (Diagenode ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Plant Biology 2021Quote: ... and digested into peptides using one round of overnight incubation at 37°C with 1:50 (enzyme:protein) trypsin (Roche, Cat. No. 03708969001) and a second round of incubation for 4 hours at 37°C with trypsin and Lys-C (Wako Chemicals ...
-
bioRxiv - Plant Biology 2022Quote: ... and digested into peptides using one round of overnight incubation at 37°C with 1:50 (enzyme:protein) trypsin (Roche, Cat. No. 03708969001) and a second round of incubation for 4 hours at 37°C with trypsin and Lys-C (Wako Chemicals ...
-
bioRxiv - Genetics 2023Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: Adherent macrophages in 6-well plates were washed with PBS containing 1 mM sodium orthovanadate and 10 mM 1,10-phenanthroline (Roche) on ice prior to lysis ...