Labshake search
Citations for Roche :
1801 - 1850 of 7954 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid transfections were performed using FuGENE 6 (Roche Diagnostics) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T cells were transfected using FuGENE®6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 uL X-tremegene-9 transfection reagent (Roche 06365787001), 0.3 μg pCMV-VSV-G (Addgene Plasmid #8454) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... ear punch biopsy samples were homogenized in lysis buffer (50 mM Tris-base, 150 mM NaCl, 5 mM EGTA supplemented with EDTA-free complete protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) and 0.5% Triton X-100) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments encompassing TPP riboswitches and the first 5 codons of the downstream gene were amplified from genomic DNA by PCR using HiFi Taq MasterMix (KAPA Biosystems, Wilmington, MA, USA) and inserted in frame preceding the nanoluciferase gene in the pNBU2 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Biochemistry 2019Quote: ... pooled together and placed in buffer H (10 mM HEPES pH 7.5, 5 mM MgCl2, 25 mM KCl, 0.25 M sucrose supplemented with Complete protease inhibitors cocktail, Roche Products Ltd, Welwyn Garden City, UK) at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cell Biology 2023Quote: ... and lysis buffer A (50 mM Tris-HCl, 5 mM EDTA, 10 mM NaN3, and Complete™ EDTA-free tablet; Roche Diagnostics, Mannheim, Germany); disrupted with glass beads at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: DRGs were collected from both WT and KO mice (8 weeks male) and were incubated in 1 mg/ml Collagenase/Dispase (Roche Diagnostics, Madison, WI, USA) at 37℃ for 60 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellet was rinsed with 500 µL of resuspension buffer (20 mM Tris pH 8, 75 mM NaCl, 0.5 mM EDTA, 1 mM DTT, 0.125 mM PMSF, 50 % glycerol, 1x Roche complete, 20 U/mL RNase Out) and centrifuged at 4000 xg at 4°C for 3 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in 10 μM BrdU:BrdC (3:1) for 16–20 h before incubation with 0.1 μg/mL colcemid (Roche) for 2-3 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were harvested and lysed in IP buffer (1 x PBS, 3 mM KCl, 2.5 mM MgCl2, 0,5 % Triton X-100 and protease inhibitors from Roche). 35 μl of this lysate was loaded onto an SDS-gel (lysate lanes) ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... planulae were washed twice with 1/3 strength artificial seawater and incubated with 50 μg/mL liberaseTM (Roche) at 37 °C for 10–20 min with occasional pipetting ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cells in 6-well plates were lysed with RIPA lysis buffer containing 1mM PMSF and 1% phosphatase inhibitor cocktail (PhosSTOP, Roche group, Swiss). The supernatant was collected after centrifuging at 14,000 rpm for 15 min at 4℃ ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were eluted with 12 ml of elution buffer (20 mM Tris, 500 mM NaCl, 6 M guanidine, 600 mM imidazole, 1 mM MgCl2 and 1X Roche protease inhibitor) and exchanged into #1 to #5 dialysis buffers in order to remove the imidazole and the Guanidine ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were incubated overnight at 4°C with a 1:2000 dilution of anti-digoxigenin antibody (Roche) in blocking buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were probed overnight at 4 °C with anti-GFP primary antibodies (Roche 11814460001; 1:1000) and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson Immunoresearch # 115-035-146 ...
-
bioRxiv - Biophysics 2021Quote: ... liposomes (final lipid concentration = 1 mM) were blocked with 4% (w/v) fatty-acid-free BSA (Roche) in HK buffer for one hour at 25°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated overnight at 4°C with 1:4000 alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) in buffer 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following an overnight incubation at 4 °C with rat anti-HA (1:500, monoclonal, Roche, Cat # 11867423001) or mouse anti-GAPDH (1:25.000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The samples were then incubated overnight at 4°C with anti-fluorescein-POD (1:2000, Roche, #11426346910).
-
bioRxiv - Genomics 2020Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... The ligated products were enriched with 8 cycles of PCR (KAPA biosystems) and size selected to 200-500 bp with Total Pure NGS beads (Omega Bio-tek) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 M Urea loading dye was supplemented with complete protease inhibitor (Roche). 100 μl Urea loading dye were used to resuspend cell pellet after NaOH treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50mM Tris-HCl (pH 8) + protease inhibitor cocktail (PIC, cOmplete Mini, Roche)] and sonicated under optimized conditions that yielded an average DNA length of ∼300 bp ...
-
bioRxiv - Systems Biology 2023Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris pH 8 in water) with Protease inhibitors (Roche, 11836170001). WCL lysate was incubated on ice for 30 min and centrifuged at max speed for 10 min to remove debris ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 8) supplemented with cOmplete™ EDTA-free protease inhibitor tablets (Roche) and Benzonase® nuclease ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: Cell viability assays were performed using a WST-8 kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 M Urea and 1x cOmpleteTM EDTA-free protease inhibitor (Roche #11873580001). Lysates were sonicated with a probe sonicator and cleared via centrifugation at 15,000x g for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.0) supplemented with one tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche). The cell solution on ice was sonicated 3 × 1 min at 90% amplitude (0.5 s cycles ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole supplemented with one EDTA-free protease inhibitor cocktail tablet (Roche) and DNAse (4 µg ml-1 final concentration) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and analysed by 25-cycle amplification using Titan One Tube RT-PCR (Roche) with primers 5’-GGC GCG GTC GGT AAA GTT-3’ and 5’-AGC GTT TTC CCG GTA TCC A-3’ (luciferase ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 7.5) supplemented with one cOmplete EDTA-free protease inhibitor cocktail tablet (Roche) per 50 ml and 1 mg/ml lysozyme ...
-
bioRxiv - Genomics 2020Quote: ... Samples were labelled with cy3 using a One-Colour Labeling Kit (Roche-Nimblegen), mixed with alignment oligos and sample tracking control oligos (Nimblegen Hybridisation and Sample Tracking Control Kits ...
-
bioRxiv - Molecular Biology 2019Quote: ... protease inhibitors were added at this wash step as well (one tablet Roche cOmplete protease inhibitor cocktail (#11836145001 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and one tablet each of PhoStop and Complete Mini (04906845001 and 04693124001, Roche). Insoluble materials were removed by centrifugation at 300 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... immediately before use one cOmplete protease inhibitor cocktail tablet (EDTA-free, Roche Diagnostics) and a phosphatase inhibitor cocktail (1 mM Na4P2O7 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pH 7.1 and one cOmplete™ Protease Inhibitor Cocktail Tablet (Roche Applied Science) per 25 ml and centrifuged at 25000 g at 4°C for 10 minutes ...
-
bioRxiv - Genomics 2021Quote: ... 10 mM imidazole pH 8.0 with one EDTA-free protease inhibitor tablet (Roche) and lysed using an Emulsiflex C3 (Avestin) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification reactions were performed using KAPA SYBR FAST One-Step qRT-PCR (Roche), with or without reverse transcriptase ...