Labshake search
Citations for Roche :
1501 - 1550 of 6508 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: 48 h bacterial cultures were pelleted and were resuspended in RIPA buffer containing protease inhibitors cocktail (Roche, Cat. No. 11 836 145 001). Samples were sonicated at 50% voltage for 5 cycles of 10 sec pulses followed by 30 sec rest on ice ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Cell Biology 2023Quote: ... 2×15 cm dishes of cells per replicate were lysed in AMBRA1 IP buffer (10 mM Tris, 150 mM NaCl, 10% glycerol, 0.5% NP-40, EDTA-free 1x protease inhibitors (Roche, 11-697-498-001), pH-8) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 1× Roche protease inhibitor cocktail) and incubated on ice for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed cells were washed with cold PBS two times and harvested in 1 % Triton X-100 in PBS buffer with 1 mM EDTA and Complete protease inhibitors (Roche). The lysates were centrifuged at 14,000 rpm for 15 minutes and the supernatant mixed with Strepavidin Sepharose High Performance (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... An equal volume of hypertonic lysis buffer (HEPES 20 mM, NaCl2 500 mM, MgCl2 1 mM, Glycerol 10%, DTT 1 mM, 1x Complete protease inhibitor [Roche]) was then added to the lysate ...
-
bioRxiv - Neuroscience 2022Quote: Right hemispheres of 3 PS19 mice brains of identical ages ranging from 1 to 6 weeks and 1 year old were gently homogenized in 1:10 ratio w/v of TBS buffer containing protease inhibitor cocktails (Roche) using a dounce homogenizer ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed in PBS and resuspended in 0.5 mL lysis buffer (10 mM Tris-HCl pH 8.0, 50 mM NaCl, 15 mg·mL-1 lysozyme, 1× protease inhibitor (Roche, Bavaria, Germany) and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit anti-BALL (Gift from A. Herzig, IF 1:20, ChIP: 2μl) mouse anti-GFP (Roche, 11814460001, IF:1:50), mouse anti-Tubulin (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... the SARS-CoV-2 containing cell culture supernatant was mixed (1:1 ratio) with the Lysis Binding Buffer from the Magnapure LC Kit # 03038505001 (Roche) to inactivate the virus ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris/HCl, 150 mM NaCl, 1 mM EDTA supplemented with 1 × protease inhibitor cOmplete Mini EDTA-free mixture from Roche) and subjected to WB assay.
-
bioRxiv - Molecular Biology 2021Quote: ... and then resuspended in 200 μL of SCE buffer (1 M sorbitol, 10 mM EDTA, 10 mM DTT, 100mM sodium citrate, 1 Roche mini-EDTA-free protease inhibitor tablet per 50 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 mM KCl, 10 mM MgCl2, 1% Triton-X100, 100 ug/ml cycloheximide, 1 mM DTT, complete EDTA-free protease inhibitors – Roche) plus 500 uL acid-washed glass beads (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by sonication in 250 ml of 1% sodium dodecyl sulfate and 1× cOmplete protease inhibitor mixture (Roche, Indianapolis, IN) in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... The blocking solution was removed and replaced with antibody solution containing 1% heat inactivated goat serum and a 1:5000 dilution of anti-DIG-AP antibody (Roche). Slides were then incubated overnight at 4°C in a humidified chamber ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted in 1x maleic acid for 1h at RT and riboprobes were detected by incubating in anti-digoxigenin-AP antibody (1:2000 in 1% sheep serum, Roche) overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Probes were detected by horseradish peroxidase (POD)-conjugated antibodies (anti-FITC-POD at 1/250 dilution, Roche; anti-DIG-POD at 1/500 dilution, Roche). Signals were amplified by biotin-conjugated tyramide (PerkinElmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in complete media (DMEM with 10% FBS and 1% antibiotics) supplemented with Collagenase-D (1 mg/mL; Roche) and incubated at 37°C for 30 min with shaking to form a single-cell suspension ...
-
bioRxiv - Microbiology 2021Quote: ... Slides were incubated at room temperature in the following primary antibodies at 1:500 dilution in 1% BSA/1xPBS: rat anti-HA (Roche) and rabbit anti-αTubulin (Abcam) ...
-
bioRxiv - Cell Biology 2022Quote: ... Triton X-100 (1%vol/vol)) containing PMSF (final concentration 1 mM) and complete protease inhibitor cocktail (without EDTA, from Roche). A 500 μl volume of glass beads was added to the tubes ...
-
bioRxiv - Biophysics 2022Quote: ... The pellet was resuspended in a 1:1 ratio (w/v) in PB supplemented with Complete Protease Inhibitor Cocktail (Roche) and afterwards dropwise frozen in liquid nitrogen before lysed in 6875D LARGE FREEZER/MILL® (SPEX SamplePrep LLC) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were extracted from adherent cells by scraping into extraction buffer (1× LysisM, 1× protease inhibitor cocktail, 2 x phosphatase inhibitor cocktail (all Roche), 2 mM sodium orthovanadate (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... islets were pre-incubated for 1 hour in KRBH buffer (described in in vitro calcium imaging) containing 1% w/v BSA (10775835001, Roche) and 3 mM glucose before incubation with 11 mM glucose ± agonists in KRBH in a shaking 37°C water-bath (80 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... the SARS-CoV-2 containing cell culture supernatant was mixed (1:1 ratio) with the Lysis Binding Buffer from the Magnapure LC Kit # 03038505001 (Roche) containing > 3 M guanidine thiocyanate (GTC) ...
-
bioRxiv - Immunology 2021Quote: Cells were collected in RIPA buffer (0.5 M EDTA, 1 M Tris-Cl pH7.5, 1 M NaCl, 200 mM, Roche protease inhibitor) at 0h ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 µl starch degradation mix (16.8 units ml-1 amyloglucosidase [#10102857001; Roche, Mannheim, Germany] and 12 units ml-1 α-amylase [#10102814001; Roche, Mannheim ...
-
bioRxiv - Neuroscience 2021Quote: ... in sucrose lysis buffer (270 nM sucrose, 10 mM Tris-HCl, 1 mM NaHCO3, 1 mM MgCl2, protease inhibitor (cOmplete Mini, Roche), phosphatase inhibitor (PhosphoStop ...
-
bioRxiv - Cell Biology 2021Quote: ... Mice tracheas were processed by peeling off the epithelium and digesting in a 1:1 mixture of DNAse II (Roche) and Liberase (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nuclei were pelleted at 1350xg for 5 min at 4°C and lysed in 5 mL LB2 (10 mM Tris-Cl pH 8.0, 5 M, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, Roche protease inhibitors) for 10 min at RT with rotation ...
-
bioRxiv - Synthetic Biology 2021Quote: The cell pellet was thawed and resuspended in lysis buffer (1×PBS containing 150 mM NaCl, pH 7.4, 0.5 mM TCEP, 0.1 mM PMSF, 1 × Roche complete protease inhibitors), and lysed in a cell disruptor ...
-
bioRxiv - Microbiology 2020Quote: After adding 1 mL of PBS (pH 7.4) containing protease inhibitor (1 tablet per 10 mL, Roche cOmplete™, #04693159001) and 500 μL of 0.5 mm diameter glass beads ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were diluted to 1 ng/µl with double distilled H2O (ddH2O) and 1 ng was used for standard SYBR Green (Roche) RT-qPCR reactions on a LightCycler480 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-SPD-5 (1:1000, a generous gift from B. Bowerman, Hamill et al., 2002) and anti-GFP (1:500, Roche) overnight at 4°C and with secondary antibodies Alexa488 (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested by centrifugation and lysed in 1% Nonidet P40/1 mM EDTA/PBS containing Complete protease inhibitors (Roche), and nuclei were removed by centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Biochemistry 2021Quote: Cell extracts were prepared in 1% NP40 lysis buffer (20 mM Hepes pH 7.5, 150 mM NaCl, 1% NP40, 50 mM NaF, 1 mM Na3VO4, 10% glycerol, and protease inhibitor cocktail from Roche) at 4 °C for 15 mins ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Cell Biology 2021Quote: HEK293T cells transfected with sfGFP-TAOK2 WT and sfGFP-TAOK2 K57A were lysed with HKT buffer (25mM HEPES pH7.2, 150mM KCl, 1% Triton X-100, 1mM DTT, 1 mM EDTA, Protease Inhibitors (Roche, Complete)) ...
-
bioRxiv - Cell Biology 2021Quote: ... and lysed in HKT buffer (25mM HEPES pH7.2, 150mM KCl, 1% Triton X-100, 1mM DTT, 1 mM EDTA, Protease Inhibitors (Roche, Complete), Halt Phosphatase Inhibitors (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... back skin was removed from mice (p0-p3) and placed in 1:1 Dispase II (Hoffman-La Roche, Basel, Switzerland):1X phosphate buffered saline (PBS ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... Cell fraction was washed twice and resuspended into 30 μL with 1 × phosphate-buffered saline (PBS) and 1 × cOmplete proteinase inhibitor (Roche). Supernatant fraction was supplemented with 1 × cOmplete and reduced to 30 μL with vacuum centrifuge ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% Na-deoxycholate, 1x Roche cOmplete Protease inhibitors), 1x 1 ml LiCL buffer (250 mM LiCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% Na-deoxycholate, 1x Roche cOmplete Protease inhibitors) in a total volume of 900 μl ...
-
bioRxiv - Physiology 2022Quote: ... the sections were blocked in TS7.5 containing 1% Blocking Reagent for 1 hr and then incubated with alkaline phosphatase-conjugated anti-digoxigenin sheep antibody (1:1000; 11093274910, Roche) and anti-EP3R rabbit antibody in this blocking solution overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 1 mM EDTA, 20% glycerol, 1% Triton X-100, and 1x cOmplete protease inhibitor cocktail from Roche, 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were incubated with primary antibodies (1:200, chicken anti-GFP, Abeam, Cat# ab13970; 1:200, mouse anti-GFP, Roche, Cat# AB_390913 ...
-
bioRxiv - Neuroscience 2022Quote: HEK293T cells transfected with N-terminally sfGFP-tagged indicated variants of TAOK1 were lysed with HKT buffer (25mM HEPES pH7.2, 150mM KCl, 1% Triton X-100, 1mM DTT, 1 mM EDTA, Protease Inhibitors (Roche, cOmplete). Lysate was precleared with Pierce™ Protein G Agarose and immunoprecipitated with anti-GFP antibodies (Roche Cat ...