Labshake search
Citations for Roche :
1451 - 1500 of 6508 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to the indicated samples in Pull-down Buffer 1 containing 1% (w:v) BSA supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche) (final volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... then resuspended in cytoplasmic lysis buffer (25 mM Tris–HCl pH 7.5, 10 mM NaCl, 1.5 mM MgCl2, 1% IGEPAL CA-630, and 1× protease inhibitor cocktail [“PI”, Roche 11836170001]) at 4°C and incubated on ice for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 mM NaCl, 0.5% Triton X-100, 1 mM DTT, 150 μM ZnSO4, 1 mM PMSF, 1xEDTA-free protease inhibitors [Roche]) overnight on a rotating wheel at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Remaining red blood cells were resuspended in extraction buffer (50 mM Tris [pH8.0], 1 mM EDTA [pH8.0], 0.5% SDS and 1 mg / ml Proteinase K [Roche, Nutley, NJ]) and incubated overnight at 55°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... the sections were washed in a serial SSC buffer and formamide solution and then preincubated in buffer 1 (100 mM Tris-HCl, pH 7.5, 150 mM NaCl) with a 1% blocking reagent (Roche) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated for 1 h at room temperature (20– 25 °C) in 0.1 M PBS with 1% blocking reagent (Roche) and 0.3% Tween 20 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were harvested and washed thrice with FACS washing buffer (1X PBS + 1 mM EDTA, pH 7.2 + 1 Complete Inhibitor EDTA-free tablet (Roche) per 50 mL buffer) ...
-
bioRxiv - Immunology 2024Quote: ... followed by tissue digestion for 1 h at 37°C with Iscov’s digestion media containing 1 mg/ml Liberase TL (Roche), and 0.5 mg/ml DNAse (Thermo ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 µg of cryoground tissue powder was placed in a 1.5mL lobind tube and brought to 1 mL with lysis buffer (1% triton, 1x PBS, 1x Roche Complete protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 1 ml cytoplasmic lysis buffer (25 mM Tris–HCl pH 7.5, 10 mM NaCl, 1.5 mM MgCl2, 1% IGEPAL CA-630, and 1× protease inhibitor cocktail [“PI”, Roche 11836170001]) at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cell pellet was resuspended in 10 mL of column buffer (20 mM Tris-HCl pH 7.5, 200 mM NaCl, 1 mM EDTA, protease inhibitors [1 Roche Mini EDTA-free tablet] ...
-
bioRxiv - Microbiology 2023Quote: ... and resuspended in lysis buffer (50 mM PBS pH 7.4, 1 mM EDTA, 5% glycerol, 1 mM PMSF and protease inhibitors from Roche). Cell lysis and protein extraction was achieved through mechanical lysis using glass beads and Precellys®24 Homogenizer (3 cycles of 30 seconds at 5500 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... 140 mM NaC1, 1 mM EDTA, 10% glycerol, 0.1% NP-40, 1 mM PMSF, and 1x protease inhibitor cocktail [Complete; Roche]). The cell pellet was flash frozen in liquid nitrogen with 1.5 mL of lysis buffer and grounded in a Spex Freezer Mill 6775 to a fine powder ...
-
bioRxiv - Microbiology 2023Quote: 293T cells transfected with pCAG AcGFP-FOS or pCAG AcGFP-JEVcore-FOS were incubated for 48 h and lysed in lysis buffer (20 mM Tris-HCl [pH = 7.4], 135 mM NaCl, 1% Triton X-100, 1% glycerol, and protease inhibitor cocktail tablets [Roche]). The cell lysates were incubated with Strep-Tactin Sepharose (IBM GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended in a 1:1 ratio (w/v) in PB supplemented with Complete Protease Inhibitor Cocktail (Roche) and afterward dropwise frozen in liquid nitrogen before lysed in 6875D LARGE FREEZER/MILL (SPEX SamplePrep LLC) ...
-
bioRxiv - Immunology 2023Quote: ... were lysed in 1 mL lysis buffer (1% IGEPAL-CA 630, 300 mM NaCl, 100 mM Tris pH 8.0, 1X Roche cOmplete Mini Protease Inhibitor Cocktail ...
-
bioRxiv - Plant Biology 2024Quote: ... were ground in liquid N2 and 100 µL extraction buffer added (125 mM Tris-Cl pH 8.8, 1% SDS, 10% glycerol, 1 mM PMSF and Complete Protease Inhibitor [Roche]). Samples were centrifuged at 7000 g for 10 min and supernatant collected ...
-
bioRxiv - Plant Biology 2024Quote: ... Root tissues were ground with liquid nitrogen in a mortar before homogenization with the extraction solution (20 mM Tris-HCl, pH 7.0, 1 mM EDTA, 1 mM DTT and a cocktail of protease inhibitors, Roche). The suspension was ultracentrifuged at 105,000 g for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: Cell lysates were prepared in a lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, EDTA-free protease inhibitor cocktail [19543200; Roche]). After centrifugation at 17,700 × g for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... previously equilibrated in Wash buffer 1 (50 mM Tris-HCl pH 7.5, 150 nM NaCl, 1% NP-40, 1x protease inhibitors (Roche)) for 3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ml urea buffer (8M urea, 1mM EDTA, 10mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) was then added and the sample was gently mixed ...
-
bioRxiv - Cancer Biology 2022Quote: ... whole-cell extracts were prepared by lysing cells in buffer X (50 mM Tris pH 8.5, 250 mM NaCl, 1 mM EDTA, 1% NP-40, protease inhibitor minitablet (Roche)) and quantified using Bradford assay (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... Frozen bacteria containing full-length or ΔUBLΔUBA UBQLN constructs were resuspended in Buffer A (50 mM Tris pH 8, 1 mM MgCl2, 1 mM PMSF, and 0.2 mg/mL DNase I and Roche Complete Mini protease inhibitor cocktail) ...
-
bioRxiv - Genomics 2022Quote: ... before being re-pelleted by centrifuging for 3 minutes at 4°C at 500g and resuspended in 180µl TMS buffer (10mM Tris-HCl pH 8, 1mM MgCl2, 1% SDS, 1× Complete Protease Inhibitor Cocktail (PIC, Roche)) with 0.4µl benzonase (E1014 ...
-
bioRxiv - Genetics 2022Quote: ... pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, Complete EDTA-free protease inhibitor cocktail tablets, Roche) with half volume of glass beads (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... the cells were lysed with ChIP-Lysis buffer (10 mM EDTA, 1% [w/v] SDS, 50mM Tris-HCl, pH 7.5, 1 tablet Protease Inhibitor Cocktail [#11836170001; Roche, Mannheim ...
-
bioRxiv - Plant Biology 2022Quote: ... 150mM NaCl, 1mM EGTA, 50mM HEPES, pH 7.5, 1 mM PMSF and 1× cOmplete protease inhibitor cocktail from Roche). 30 μl GST beads (Glutathione Sepharose 4 Fast Flow ...
-
bioRxiv - Plant Biology 2022Quote: The samples were ground in liquid nitrogen and homogenized in the extraction buffer (100 mM Tris-HCl pH 8.8, 150 mM NaCl, 1 mM EDTA, 20% glycerol, 1 mM PMSF, 1x cOmplete protease inhibitor cocktail from Roche, 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Systems Biology 2022Quote: ... 6 mM MgCl2, 1 mM EDTA, 100 mM NaCl, 0.1% Tx-100, pH 8, and 1× Protease Inhibitor Cocktail, Roche) at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... The pellet was washed twice with 300 μl sodium phosphate buffer (20 mM Na-phosphate pH 6.8, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche) with centrifugation at 16,000g for 20 min between washes ...
-
bioRxiv - Physiology 2024Quote: ... Pellets were resuspended with binding buffer (100 mM HEPES, 1 mM EDTA, 1% SDS, pH 7.4, and protease inhibitor cocktail from Roche) by vortexing for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were incubated with CENP-B box probe-Cy3 (PNAbio) 1:1 in hybridization buffer (20mM Tris, pH 7.4, 60% formamide, 0.5% of blocking reagent (Roche 11096176001)) ...
-
bioRxiv - Immunology 2024Quote: ... Cells were lysed in RIPA buffer (50 mM Tris HCL, 150 mM NaCl, 1% SDS, 0.5% Na-deoxycholate, 1× Complete protease inhibitor (Roche)) for 30 min on ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... then resuspended in cytoplasmic lysis buffer (25 mM Tris–HCl pH 7.5, 10 mM NaCl, 1.5 mM MgCl2, 1% IGEPAL CA-630, and 1× protease inhibitor cocktail [“PI”, Roche 4693132001]) at 4°C and incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... at a concentration of 1:1500 for 1 h at RT and detected using anti-rabbit HQ (Roche, USA) for 8 min ...
-
bioRxiv - Microbiology 2024Quote: ... previously digested with the same enzymes and incubated for 1 hour at 37°C with 1 µl of alkaline phosphatase from calf intestine (20.5 U/µl; Roche). Ligation reactions were carried out overnight at 16°C using 1µl of T4 DNA Ligase (20 U/µl ...
-
bioRxiv - Microbiology 2024Quote: ... the PfCHC::GFP iRBCs were used with anti-GFP (mouse mAb 1:1000, Roche, 11814460001, rabbit ab6556, 1:1000), ERD2 (rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were then blocked for 1 h and incubated with an anti-DIG antibody (Roche 11093274910, RRID:AB_514497, 1:2000) diluted in MABT buffer (0.1 M maleic acid pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single cell suspension was obtained by digesting DRGs in Collagenase type 1 and Dispase II (1 mg/ml; Roche) at 37°C for 70 min18 ...
-
bioRxiv - Biochemistry 2024Quote: ... were diluted 1:1 in hypotonic buffer (10 mM HEPES pH 7.5, 20 mM KCl, 10 mM MgCl2, Roche Complete Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2024Quote: Cell pellet was collected and re-suspended in lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, Roche complete protease inhibitor ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4×PIC (Roche; Cat#05056489001)) was added to the pellets ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 mM ATP (Roche, 10519979001)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Version 4 (Roche, Mannheim, Germany), using MagNa Lyser Green Beads (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... 10% glycerol v/v, 0.4% NP-40 v/v, and cOmplete Protease Inhibitor Tablet according to instructions for Roche # 11 836 170 001) and processed as described (Garceau et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...