Labshake search
Citations for Roche :
101 - 150 of 3378 citations for Western Blot Strip It Buffer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Using the Lumi-Light Western Blotting Substrate (Roche), 3xFLAG-TisB was visualized and documented in a chemiluminescence imager (PeqLab ...
-
bioRxiv - Microbiology 2019Quote: ... blots were developed using NBT and BCIP (Roche).
-
bioRxiv - Plant Biology 2019Quote: ... Blots were probed with anti-HA-HRP (Roche) or anti-GFP-HRP (Miltenyi Biotec ...
-
bioRxiv - Neuroscience 2019Quote: ... and concentration was assessed via dot blot (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Cell Biology 2020Quote: ... and blocked with Western Blocking Reagent (Roche, Indianapolis, IN).
-
bioRxiv - Cell Biology 2020Quote: ... and blocked with Western Blocking Reagent (Roche, Indianapolis, IN). Lamin A proteins were detected with mouse anti-myc antibodies (clone 4A6 ...
-
bioRxiv - Physiology 2020Quote: ... Sections were blocked in Western Blocking Reagent (Roche #11921673001) and a second blocking step with goat anti-mouse IgG (H+L ...
-
bioRxiv - Biochemistry 2020Quote: ... and the membrane blocked using Western Blocking Reagent (Roche). Lamin proteins were detected using mouse anti-myc antibodies (clone 4A6 ...
-
bioRxiv - Plant Biology 2020Quote: ... detected by Western-blotting using anti-HA antibody (Roche) and anti-Flag antibody (Sigma).
-
bioRxiv - Cell Biology 2020Quote: ... peroxidase substrate (Lumi-Light Western Blotting Substrate #12015200001, Roche) and an ECL Chemocam Imager (Intas) ...
-
bioRxiv - Developmental Biology 2020Quote: ... We used Lumi-LightPLUS western blotting substrate (ROCHE, 12015196001) and high performance chemiluminescence film (Amersham Hyperfilm™ ECL ...
-
bioRxiv - Neuroscience 2021Quote: ... After 1 hour in Western blocking reagent (Roche Diagnostics), membranes were incubated overnight with primary antibodies ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.5% Roche Western Blocking Reagent (Roche/Sigma 11921673001). Animals were then developed with colorimetric substrate (NBT/BCIP ...
-
bioRxiv - Cancer Biology 2022Quote: Blood was sampled in mice by nicking the tail vein and blood glucose levels were measured using ACCU-CHEK Active test strips read by an ACCU-CHEK Active meter (Roche Diagnostics, Indianapolis, IN) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: Blood glucose measurements were collected with a glucometer (ACCU−CHEK Performa, USA) and the proper test strips (F. Hoffmann-La Roche AG, Basel, Switzerland). Blood lactate was also measured with the Lactate Pro 2 handheld device and respective test strips (AKRAY Europe B.V. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Blots were developed with GFP mouse antibody from Roche Applied Science (Indianapolis ...
-
bioRxiv - Bioengineering 2021Quote: ... The blood glucose levels of ZDF rats in each group were measured using a digital glucose meter and test strips (Accu-Chek® Sensor, Roche Inc., Mannheim, Germany) 2 or 3 days prior to surgery and at the study endpoint ...
-
bioRxiv - Neuroscience 2021Quote: ... Glycemia was assessed with blood obtained at decapitation using a glucometer with reagent strips (ACCU-CHEK ® Aviva Nano; Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... A tail vein blood sample was applied on Accu-Chek® Performa Test strip (Cat# 06454038020) and glucose concentration was measured with Accu-Chek® Performa (Cat# 05894964014) blood glucose meter (both from Roche Diagnostics, Manheim, Germany).
-
bioRxiv - Immunology 2021Quote: ... membranes were blocked in western blotting reagent (Roche, Basel, Switzerland) diluted 1:10 in TBS-T buffer (Tris-buffered saline with 1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then treated with Western Blocking Reagent (Roche) and probed with anti-biotin ...
-
bioRxiv - Neuroscience 2024Quote: Primary antibodies used for Western blotting include GFP (11814460001; Roche), pThr73-Rab10 (ab230261 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lumi-Light ECL-plus western blotting kit was from Roche Applied Science.
-
bioRxiv - Cell Biology 2021Quote: ... The blot was washed and exposed with CDP-Star (Roche) and visualized in an ImageQuant LAS 4000 (Cytiva) ...
-
bioRxiv - Plant Biology 2021Quote: ... CAD1 accumulation blots were probed with primary α-GFP (Roche) and secondary α-mouse-HRP (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... blots were respectively immunodetected with an anti-HA Peroxidase (Roche) or anti-myc antibody (Abmart) ...
-
bioRxiv - Plant Biology 2024Quote: ... blots were probed with mouse anti-GFP antibody (Roche, #11814460001) used at 1/5000 dilution followed by rabbit Anti-Mouse HRP secondary antibody (AbCam ab6728 ...
-
bioRxiv - Immunology 2024Quote: ... blots were probed with 1:500 anti-HA (Roche, #11867423001). Anti-mouse IgG-HRP (Abcam ...
-
bioRxiv - Pathology 2019Quote: ... 60 min and 120 min after glucose treatment were examined using commercial blood glucose test strips (ACCU-CHEK®, Roche Diabetes Care GmbH, Shanghai, China). For insulin resistance detection ...
-
bioRxiv - Pathology 2020Quote: Fasting blood glucose was measured in blood samples from the tail vein using a glucometer and reactive strips (Accu-Chek® Performa, Roche LTDA. Jaguaré, SP, Brazil). Body weight ...
-
bioRxiv - Cell Biology 2021Quote: ... Cryosections were blocked for 1h with 1% Western blocking reagent (Roche) containing 0.1% Triton in PBST ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection was conducted with Lumi-Light PLUS Western Blotting Substrate (Roche) and images were obtained with LAS3000 (Fujifilm ...
-
bioRxiv - Molecular Biology 2021Quote: ... The membrane was blocked with 1:10 Western Blocking Reagent (Roche) in TBST (20 mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2019Quote: ... Immunoblotting was performed following blocking in 10% Western blocking reagent (Roche) using antibodies against DNMT3B (Cell Signalling Technology ...
-
bioRxiv - Genetics 2020Quote: ... Eggs were then blocked in 10% Western Blocking Reagent (WBR, Roche) in PBS with 0.1% Tween 20 and incubated with gentle shaking overnight at 4°C with mouse anti-Broad-core (1:250 uL ...
-
bioRxiv - Neuroscience 2020Quote: ... The PVDF membranes were blocked in 5% Western Blocking Reagent (Roche) then probed with primary and secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein visualization was performed by chemiluminescence using LumiLight western blotting (Roche) and ImageQuant 800 (GE Healthcare).
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were blocked overnight (1% Roche Western Blotting Reagent (WBR), Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-HA antibodies were from Roche (clone 12CA5 for Western blotting) or from SantaCruz (clone Y11 for immunofluorescent staining) ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were visualized using Lumi-Light Western Blotting Substrate (Roche, Switzerland). The signal was detected using the ChemiDOC MP Imaging System (Bio-rad ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of 10x Western blocking reagent (Roche GmbH; Mannheim, Germany)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were blocked with 1% Western Blocking Reagent (WBR; Roche #11921681001) or 5% BSA in TBST buffer for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked for 30 minutes in 1X Western Blocking Reagent (WBR, Roche #) in PBT at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... the blots were incubated with the Anti-HA-Peroxidase (#12013819001, Roche), and detected by ImageQuant LAS4000 (GE Healthcare).
-
bioRxiv - Cell Biology 2023Quote: ... The blot was the incubated with GFP antibody (1:1000, Roche) diluted in 5% non-fat milk at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... Western blotting was performed with mouse anti-GFP (1/1,000, Roche, 118144600001) and rabbit anti-ECH73 (1/1,000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Secondary antibodies conjugated with HRP and Lumi-Light Western Blotting Substrate (Roche) were used to visualize specific protein bands ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by SDS-PAGE and Western Blotting using anti-GFP antibody (Roche), HRP-conjugated anti-mouse secondary antibody (Roche ...
-
bioRxiv - Genomics 2021Quote: ... proteins were visualized using the lumi-light plus western blotting substrate (Roche).