Labshake search
Citations for Roche :
1301 - 1350 of 6347 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... UK) following the manufacturer’s instructions and endpoint genotyping was conducted from fluorescence using a Lightcycler 480 Instrument II (Roche, Indianpolis, IN). The Rht markers were coded as lines with Rht-B1b (1) ...
-
bioRxiv - Plant Biology 2021Quote: ... and NADP-ME3 (Zm00004b015828) were quantified via qRT-PCR using a Roche Light Cycler 480 II using Roche SYBR green I (Roche 04707516001). The delta cT method was used to quantify relative gene expression of PEPCK1 and NADP-ME3 over time ...
-
bioRxiv - Immunology 2021Quote: ... The transcripts for genes of interest were measured by real-time PCR with a Lightcycler 480 II system (Roche, Basel, Switzerland) and a Brilliant III SYBR Green Master mix (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... A grid of slits was cut into the skin sheets to aid enzymatic access and the skin was then treated with 2U/ml dispase II (Roche, 04942078001) in RPMI at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Physiology 2023Quote: ... The qPCR program was initiated at 95°C for 10 minutes to denature the cDNA and activate the TAQ polymerase enzyme in a thermocycler (Lightcycler® 480 II Roche thermocycler ...
-
bioRxiv - Microbiology 2024Quote: ... 500 µL of lysis buffer II (Tris-HCl pH 4.7 50 mM, NaCl 150 mM, EDTA 1mM, Triton X100 1%, Roche Antiprotease Cocktail) was added and samples were sonicated for 30’ (Covaris ...
-
bioRxiv - Biophysics 2024Quote: ... cells were imaged using FLUOVIEW FV3000 confocal laser scanning microscope (Evident) and then lysed with BIORUPTOR II (BM Bio) in 1xPBS supplemented 1x cOmplete™ Protease Inhibitor Cocktail (Roche) in Protein LoBind Tubes (Eppendorf) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 30 min at 37°C and additionally with 1 mg/ml of collagenase solution (Roche) for 12-18 hr at 37°C with agitation ...
-
bioRxiv - Immunology 2019Quote: ... skin samples were digested for 1h at 37°C using 1 U/mL Liberase TM (Roche) and 5 µg/mL DNAse I (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... To increase probe permeability embryos were incubated at 21°C in 10µg/ml proteinase K (Roche) for the following durations ...
-
bioRxiv - Physiology 2019Quote: ... Then all samples were incubated with TUNEL reaction mix for 60 minutes at 37 °C (Roche). After washing ...
-
bioRxiv - Molecular Biology 2021Quote: ... embryos were washed with hybridization buffer at 55 ̊C and incubated with Western Blocking Reagent (Roche) at room temperature for one hour ...
-
bioRxiv - Cancer Biology 2021Quote: ... Chromatin was then de-crosslinked overnight at 65°C in the presence of proteinase K (Roche), purified by phenol and phenol-chloroform extractions ...
-
bioRxiv - Cell Biology 2019Quote: ... the slides were incubated for 5 h at 8°C with mouse anti-DIG antibody (Roche, Basel ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated overnight at 4 °C with rat anti-HA Abs at 1:200 (Roche) and guinea-pig anti-red fluorescent protein (RFP ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated at 37°C for 30 min with 0.5 mg/ml liberase DL (Roche Basel, Switzerland) and 100 U/ml DNase (Roche Basel ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 30 minutes at 37 °C and then with ∼1.2 mg/mL Proteinase K (3115879001, Roche) overnight at 65°C ...
-
bioRxiv - Immunology 2019Quote: ... Tissue was transferred to C-tubes (Miltenyi) and digested using Liberase™ (Roche, 57.6 μg/ml) in the presence of DNase I (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... the sections were incubated overnight at 4°C with alkaline phosphatase–conjugated antibodies to digoxigenin (Roche) at a dilution of 1:2000 in the same solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Annealed oligonucleotides were subsequently phosphorylated for 30 minutes at 37°C using T4 polynucleotide kinase (Roche). 5 μL of 25 × diluted oligonucleotides and 50 ng of the digested and dephosphorylated vector were ligated overnight at 16°C using T4 Ligase (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... -C and -G in a pX330 vector was transfected into HAP1 cells using X-tremeGENE (Roche). Single cells were FACS sorted based on W6/32 negativity to obtain knockout clones for HLA-A ...
-
bioRxiv - Microbiology 2019Quote: ... Contaminating DNA was digested by DNase I (Roche; 1 U/µg RNA, 60 min, 37°C) in the presence of RNase inhibitor (RNaseOUT ...
-
bioRxiv - Microbiology 2019Quote: ... Microarrays were hybridized for 20 hours at 42°C with the NimbleGen Hybridization System (Roche NimbleGen). Afterwards ...
-
bioRxiv - Microbiology 2020Quote: ... Viruses were treated for 30 min at 37°C with 1,000 U of DNase I (Roche). As a control ...
-
bioRxiv - Cancer Biology 2022Quote: ... Then the samples were incubated overnight at 4 °C with proliferation marker Ki67 (790–4286, Roche). After 3 washes with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and stored at least 1 hour at −20 °C before staining with Tdt reaction mix (Roche Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 42 °C and detection was performed by chemiluminescence using anti-Digoxigenin-AP Fab fragments (Roche) and CDP-Star chemiluminescent substrate (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... embryos were washed with hybridization buffer at 55°C and incubated with Western Blocking Reagent (Roche) at room temperature for ∼2 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... PH 7.5)) and then incubated overnight at 4 °C in anti-DIG POD antibody (Roche, 11207733910) diluted 1:300 in blocking solution ...
-
bioRxiv - Genomics 2023Quote: ... final extension 5 min at 62 °C) using the KAPA HiFi HotStart Ready Mix (Kapa Biosystems). Amplified libraries were purified ...
-
bioRxiv - Biochemistry 2023Quote: HDX of unbound and bound c-Met (1:2.2 ratio with mAb (Roche Diagnostics GmbH, Germany)) was performed by diluting c-Met into labelling buffer (20mM Histidine ...
-
bioRxiv - Plant Biology 2023Quote: ... The membranes were probed overnight at 4°C with monoclonal anti-GFP primary antibodies (Roche, 11814460001) at 1:1,000 and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2023Quote: ... HBE were processed for protein lysates and stored at -20°C (Complete Lysis-M Roche diagnostics). NET dosage was an average of extracellular dsDNA concentration (QuantiFluor ONE dsDNA System ...
-
bioRxiv - Microbiology 2023Quote: ... 720 μL concentrated solution was treated with 1000U/mL DNase I (37°C, 2h) (Roche, China) before viral DNA extraction ...
-
bioRxiv - Cancer Biology 2023Quote: ... Collected media was incubated for 2 hours at 55°C with 20mg/ml proteinase K (Roche). Then ...
-
bioRxiv - Physiology 2024Quote: ... digested for 30 minutes at 37°C with 0.5-1 µg/ml of proteinase K (Roche), quickly rinsed with cold PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... The beads were washed three times in Buffer C complete including 1x complete protease inhibitors (Roche) and 0.5 mM DTT ...
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were incubated overnight at 4°C in horseradish peroxidase-coupled anti-FITC antiserum (11426346910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were incubated overnight at 4°C in alkaline phosphatase-coupled anti-FITC antiserum (11426338910, Roche) diluted 1:5000 in blocking buffer ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...