Labshake search
Citations for Roche :
1201 - 1250 of 6347 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... PCR was performed using 96-well white PCR plates using the LightCycler® 480 II system (Roche Applied Science, Germany). The amplification started with an initial denaturation step at 95°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using DyNAmo ColorFlash SYBR Green qPCR Master Mix (Thermo) and a LightCycler® 480 Instrument II (Roche). Signals of amplified products were verified using melting curve analysis and mRNA levels were normalized to Beta-Actin ...
-
bioRxiv - Cancer Biology 2021Quote: ... The candidate cells were selected with 2 µg/ml puromycin for a week and the selected cells were analysed by High-resolution melting peaks analysis using real-time PCR (Light cycler 480 II, Roche).
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCR (qPCR) analyses of cDNA (diluted at 1/10) were performed in triplicate with a LightCycler 480 II (Roche) using the SYBR Green I Master mix (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... Real-time RT-qPCR reactions were run in a 384-well LightCycler®480 II System (Roche Diagnostics, Mannheim, Germany) using the GoTaq qPCR Mastermix (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantification of transcript levels was carried out using SYBR Green reactions with 5 ng cDNA in a 20 μl volume on a Light Cycler 480 II (Roche) relative to the reference gene UBC10 (POLYUBIQUITIN10 ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was generated from 1 μg total RNA with qScript cDNA SuperMix (Quantabio) and analyzed on a LightCycler 480 II apparatus (Roche) with the SYBR Green I Master mix (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... the water was removed with a pipette and 75 μl of Luminol-Mastermix (2 μg/ml horseradish peroxidase (Type II, Roche), 5μM L-012 (WAKO chemicals) ...
-
bioRxiv - Plant Biology 2021Quote: ... Elicitation was performed with the indicated concentration of peptides and 2 μg/ml horseradish peroxidase (Type II, Roche, Penzberg, Germany) and 5μM L-012 (FUJIFILM Wako chemicals ...
-
bioRxiv - Microbiology 2020Quote: ... Amplifications were performed using a 96-well plate in a pre-heated LightCycler® 480 Instrument II (Roche, Basel, Switzerland). Each well contained a 10 μl reaction mixture comprising 1 μl DNA template ...
-
bioRxiv - Cell Biology 2021Quote: ... One µl of cDNA was specifically and quantitatively amplified using Biotool 2x SybrGreen qPCR master mix (Stratech, UK) following the cycling parameters established by the manufacturer on a light cycler 480 II (Roche) and using GAPDH as a control for normalisation ...
-
bioRxiv - Developmental Biology 2022Quote: ... and prepared for flow cytometry immunostaining as follows: Matrigel-embedded organoids were digested using a HBSS solution containing 10 U/ml dispase II (Roche) and 125 U/ml of collagenase type IV (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... All qPCR reactions were performed in 10-μl reactions with two technical replicates in a 384-well format and read out using a LightCycler 480 Instrument II (Roche). For multiplexed targeting reactions ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR was performed using the KOD SYBR®qPCR Mix (Toyobo Life Science) with Light Cycler 480 II (Roche). Primers used to amplify the cDNAs are shown in Supplemental Table 5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mice tracheas were processed by peeling off the epithelium and digesting in a 1:1 mixture of DNAse II (Roche) and Liberase (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... VENTANA® standard signal amplification and ultra-wash was followed by counterstaining with Hematoxylin II (#790-2208, Roche, Basel, Switzerland) and blueing reagent (#760-2037 ...
-
bioRxiv - Genomics 2022Quote: Human embryonic hindlimb muscles were collected in sterile PBS and mechanically dissociated using fine scissors in 10 mL (per gram of tissue) of enzyme solution containing 2.5 U/mL Dispase II (Roche, #4942078001) and 1 mg/mL Collagenase B (Roche ...
-
bioRxiv - Genomics 2022Quote: ... Tissue was then mechanically dissociated with fine scissors in 10 mL (per gram of tissue) enzyme solution mixed with 2.5 U/mL Dispase II (Roche, #4942078001) and 1 mg/mL Collagenase B (Roche ...
-
bioRxiv - Plant Biology 2020Quote: The relative expression level of C4 genes were studied by using qPCR (Light Cycler 480 II, Roche Molecular Diagnostics, USA) (Chowrasia et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... 3.5 µl of diluted samples was used to assemble a 10 µl reaction and run on a Light Cycler 480 II (Roche) with the primers CAGAGTTCTACAGTCCGACGAT and TTGGCACCCGAGAATTCCA (matching each probe’s ends ...
-
bioRxiv - Cell Biology 2020Quote: Quantitative real-time PCR (qPCR) was performed using synthesized cDNA with SYBR Select Master Mix (Applied Biosystemes) on a Light Cycler 480 II (Roche) or the QuantStudio 5 RealTime PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated as described above and gene expression was measured in a LightCycler480 II using the Universal Probe Library system (Roche). Expression was normalized to Actin and Tubulin using the delta/delta CT method.
-
bioRxiv - Pathology 2021Quote: ... Quantitative PCR (qPCR) assay was performed by using the SYBR qPCR Master Mix (Vazyme) on Roche Lightcycle480 II Sequence Detection System (Roche). Gene expression levels were normalized by Actb ...
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression was quantified in technical triplicates using RT-qPCR performed in 384-well plates on a Roche LightCycler 480 Instrument II with dual hybridisation probes from The Universal ProbeLibrary (Roche). Oligonucleotide sequences used for RT-qPCR are listed in Appendix Table S3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pelleted tissue was weighted and resuspended in the enzymatic digestion mix composed by 2,4 U/ml dispase II (4 ml/g of muscles) (Roche 04942078001) dissolved in Dulbecco’s phosphate buffered saline (D-PBS ...
-
bioRxiv - Microbiology 2020Quote: ... HBsAg and HBeAg were measured using Elecsys HBsAg II (cobas) and Elecsys HBeAG (cobas) by cobas e 411 analyzer (Roche).
-
bioRxiv - Immunology 2020Quote: ... The abundance of transcripts from the genes of interest was measured by quantitative real-time PCR with the Light Cycler 480 II system (Roche) with a Brilliant III SYBR master mix (Agilent ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Cell Biology 2021Quote: ... back skin was removed from mice (p0-p3) and placed in 1:1 Dispase II (Hoffman-La Roche, Basel, Switzerland):1X phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR was performed using TB Green Premix ExTaq II (Takarabio, Otsu, Japan) and a LightCycler96 (Roche Basel, Switzerland). Primers used for qPCR are listed in Table S1.
-
bioRxiv - Molecular Biology 2021Quote: ... For RT-qPCR RNAs were reverse transcribed (Superscript II, Invitro-gen) using random primers and quantified by qPCR (Fast start SYBR green, Roche). Primer sequences are described below ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-Time qRT-PCR was performed using the Real-Time 2xHS-PCR Master Mix Sybr B (A&A Biotechnology) on a LightCycler 480 II qPCR System (Roche) with custom-designed primers for Gli1 (Fwd ...
-
bioRxiv - Biochemistry 2022Quote: ... Three biological replicates of sRNA from infected and noninfected MT-4 cells and cDNA samples after NAD captureSeq were measured in two technical repeats on LightCycler 480 II (Roche) by Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Matrigel drops (at least 4 samples per time point) were first digested with HBSS solution containing 10 U/ml dispase II (Roche) and 125 U/ml collagenase type IV (Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.25 µM forward and reverse primers (Extended Data Table 1) on a LightCycler 480/II 384 (Roche, serial #6073). Four technical replicates were performed per biological replicate qPCR primer set ...
-
bioRxiv - Molecular Biology 2022Quote: ... dissociated with an equal mixture of 4 mg/ml of collagenase D and dispase II (Roche Applied Science, Indianapolis, IN) and cultured in F-12K (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... Mef2a mRNA expression was then assessed by qPCR (PowerTrack SYBR Green Master Mix, Applied Biosystems, LightCycler 480 Instrument II, Roche), along with that of 36b4 mRNA for data normalization ...
-
bioRxiv - Developmental Biology 2022Quote: Dorso-lateral skins of E14.5 C57BL/6JOlaHsd mouse embryos were dissected and enzymatically separated using 2.5 U/ml Dispase II (Roche, Tokyo, Japan) in 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates using the 5x HOT FIREPol EvaGreen qPCR Supermix (Solis Biodyne) and the LightCycler 480 II instrument (Roche). For RT-qPCR normalization ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed using the 5x HOT FIREPol EvaGreen qPCR Supermix (Solis Biodyne) and the LightCycler 480 II instrument (Roche) as technical triplicates ...
-
bioRxiv - Physiology 2023Quote: ... Nematode DNA was then quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... Nematode DNA was then quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The reverse-transcribed cDNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Physiology 2023Quote: ... The fly DNA was then quantified using the Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...