Labshake search
Citations for Roche :
1051 - 1100 of 6811 citations for Recombinant Human Collagen Type II Alpha 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... Total DNA was quantified with Maxima SYBR Green/ROX qPCR Master Mix on a LightCycler 480 II System (Roche) with following programmes ...
-
bioRxiv - Microbiology 2023Quote: ... First-strand cDNA was synthesized from 2 μg of total RNA using Superscript II reverse transcriptase (Roche, Mannheim, Germany). qPCR was performed in a 20 μl reaction mixture containing 10 μl of SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: Skin samples collected from the ventral neck area of 4-5 mice were minced in Hank’s balanced solution (HBSS) and incubated at 4°C overnight with 1.5mg/ml dispase II (Roche; 25766800). The next day ...
-
bioRxiv - Molecular Biology 2024Quote: ... membrane hybridization and detection were performed using DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche, #11585614910) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Vector DNA was transiently transfected into human embryonic kidney (HEK) cells using Fugene-6 (Roche Molecular Biochemicals) transfection reagent ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2021Quote: Total RNA was retrotranscribed and cDNA was quantified using the Universal Human Probe Roche library (Roche Diagnostics). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and goat anti-human AF647 (Stratech 109-606-088- JIR)) DNA was then stained with DAPI (Roche) and coverslips mounted with Vectashield (Vector Laboratories - Vector H-1000).
-
bioRxiv - Immunology 2024Quote: Mice or Human CD4 T cells were lysed using RIPA buffer supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitors (Pierce) ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR reactions used a THUNDERBIRD SYBR qPCR Mix (TOYOBO) and were amplified on a LightCycler 480 System II (Roche). The specific primer pairs used for qRT-PCR analyses were designed using the Primer Express version 2.0 software program (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR analysis was performed using primers detailed in Supplementary file 7 on a Roche Lightcycler 480 II (Roche Holding AG) using LightCycler 480 SYBR Green I Master mix (Roche Holding AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... targeting the HBV_circ_1 B site was labelled with DIG-11-dUTP by digoxin using a Dig high primer DNA labelling kit and detection starter kit II (Roche). Hepatic tissue paraffin sections of HCC patients were treated with dewaxing and then digested with protease K ...
-
bioRxiv - Cell Biology 2020Quote: ... Triplicate qPCR reactions of the Telomeric (T) product and the Single copy gene (S) (HBB) were amplified using a Roche LightCycler 480 II (Roche) using the following programs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... three to four-week old mice were euthanized and the mouse ventral forelimb skin was dissected for dissociation in Dispase II (Roche) to isolate epidermal whole mount preparations ...
-
bioRxiv - Genomics 2020Quote: ... approximately 3,000 individuals were collected from the wild and cleaned as described above and homogenized using BioMasher II (Nippi) in PBS (Nippon Gene) on ice with protease inhibitors (Roche). The lysate was heated at 92°C for 20 min ...
-
bioRxiv - Molecular Biology 2022Quote: The quantification of cDNA obtained from reverse transcribed RNA and DNA recovered from ChIP experiments was done with the Roche LightCycler480 II device and LightCycler 480 SYBR Green I Master (Roche) reagent according to the manufacturer’s instructions ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... cDNA synthesis and PCR amplification were carried out in the same tube using the qScript One-Step SYBR Green qRT-PCR Kit (Quantabio) and a LightCycler480 II (Roche). All reactions were performed in triplicate ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR was performed using 96-well white PCR plates using the LightCycler® 480 II system (Roche Applied Science, Germany). The amplification started with an initial denaturation step at 95°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using DyNAmo ColorFlash SYBR Green qPCR Master Mix (Thermo) and a LightCycler® 480 Instrument II (Roche). Signals of amplified products were verified using melting curve analysis and mRNA levels were normalized to Beta-Actin ...
-
bioRxiv - Molecular Biology 2019Quote: ... Following the preparation of plates an incubation at 4°C for at least 60 min was performed before the plates were analyzed on a LightCycler 480 II (Roche) using 45 cycles and a temperature profile recommended by the manufacturer for miRCURY SYBR® Green mastermix ...
-
bioRxiv - Cancer Biology 2021Quote: ... The candidate cells were selected with 2 µg/ml puromycin for a week and the selected cells were analysed by High-resolution melting peaks analysis using real-time PCR (Light cycler 480 II, Roche).
-
bioRxiv - Plant Biology 2021Quote: ... Real-time RT-qPCR reactions were run in a 384-well LightCycler®480 II System (Roche Diagnostics, Mannheim, Germany) using the GoTaq qPCR Mastermix (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantification of transcript levels was carried out using SYBR Green reactions with 5 ng cDNA in a 20 μl volume on a Light Cycler 480 II (Roche) relative to the reference gene UBC10 (POLYUBIQUITIN10 ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA was subjected to pre-hybridization and hybridization using a DIG High Prime DNA labeling and detection starter kit II (Roche) according to the manufacturer’s instructions with a DIG-labeled probe of ∼100-200 bp annealing in the targeted gene (for primer sequences ...
-
bioRxiv - Microbiology 2020Quote: ... Amplifications were performed using a 96-well plate in a pre-heated LightCycler® 480 Instrument II (Roche, Basel, Switzerland). Each well contained a 10 μl reaction mixture comprising 1 μl DNA template ...
-
bioRxiv - Genomics 2020Quote: ... cDNAs were prepared using Superscript II reverse transcriptase (Life Sciences) using hexamer random primers and qPCR was performed using the SybrGreen aMster kit (Roche) on a LightCycler 480 II ...
-
bioRxiv - Cancer Biology 2020Quote: ... CAL33-c5 and CAL33-c11were seeded in 96-well plates and cell viability was determined with the colorimetric Cell Proliferation Kit II (XTT) (Roche) 24 ...
-
bioRxiv - Cell Biology 2021Quote: ... One µl of cDNA was specifically and quantitatively amplified using Biotool 2x SybrGreen qPCR master mix (Stratech, UK) following the cycling parameters established by the manufacturer on a light cycler 480 II (Roche) and using GAPDH as a control for normalisation ...
-
bioRxiv - Developmental Biology 2022Quote: ... and prepared for flow cytometry immunostaining as follows: Matrigel-embedded organoids were digested using a HBSS solution containing 10 U/ml dispase II (Roche) and 125 U/ml of collagenase type IV (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... All qPCR reactions were performed in 10-μl reactions with two technical replicates in a 384-well format and read out using a LightCycler 480 Instrument II (Roche). For multiplexed targeting reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μm sections were stained with H&E and Masson trichrome (Trichrome II Blue staining kit at Nexus special stainer; Roche). Immunohistochemical analysis was performed on cryosections and paraffin sections using a Bench Mark XT automatic staining platform (Ventana ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR was performed using the KOD SYBR®qPCR Mix (Toyobo Life Science) with Light Cycler 480 II (Roche). Primers used to amplify the cDNAs are shown in Supplemental Table 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... VENTANA® standard signal amplification and ultra-wash was followed by counterstaining with Hematoxylin II (#790-2208, Roche, Basel, Switzerland) and blueing reagent (#760-2037 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Genomics 2022Quote: Human embryonic hindlimb muscles were collected in sterile PBS and mechanically dissociated using fine scissors in 10 mL (per gram of tissue) of enzyme solution containing 2.5 U/mL Dispase II (Roche, #4942078001) and 1 mg/mL Collagenase B (Roche ...
-
bioRxiv - Genomics 2022Quote: ... Tissue was then mechanically dissociated with fine scissors in 10 mL (per gram of tissue) enzyme solution mixed with 2.5 U/mL Dispase II (Roche, #4942078001) and 1 mg/mL Collagenase B (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... according to manufacturer’s protocol. Quantitative PCR was performed using SensiMixTM II Probe Kit (Cat#. BIO-83005) with Universal ProbeLibrary (Roche Diagnostics), and the CFX96 Touch System (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: The relative expression level of C4 genes were studied by using qPCR (Light Cycler 480 II, Roche Molecular Diagnostics, USA) (Chowrasia et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... 3.5 µl of diluted samples was used to assemble a 10 µl reaction and run on a Light Cycler 480 II (Roche) with the primers CAGAGTTCTACAGTCCGACGAT and TTGGCACCCGAGAATTCCA (matching each probe’s ends ...
-
bioRxiv - Cell Biology 2020Quote: Quantitative real-time PCR (qPCR) was performed using synthesized cDNA with SYBR Select Master Mix (Applied Biosystemes) on a Light Cycler 480 II (Roche) or the QuantStudio 5 RealTime PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated as described above and gene expression was measured in a LightCycler480 II using the Universal Probe Library system (Roche). Expression was normalized to Actin and Tubulin using the delta/delta CT method.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Labelling efficiencies were tested by dot blotting with anti-digoxigenin alkaline phosphatase conjugate and CSPD chemiluminescence substrate for alkaline phosphatase from DIG High Prime DNA Labelling and Detection Starter Kit II (Roche) according to the manufacturer`s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using a Bio-Rad sequence detection system according to the manufacturer’s instructions using a double-stranded DNA-specific SYBR Green Premix Ex TaqTM II Kit (Roche, Switzerland). Experiments were conducted in duplicate in three independent assays ...
-
bioRxiv - Pathology 2021Quote: ... Quantitative PCR (qPCR) assay was performed by using the SYBR qPCR Master Mix (Vazyme) on Roche Lightcycle480 II Sequence Detection System (Roche). Gene expression levels were normalized by Actb ...
-
bioRxiv - Genomics 2020Quote: ... These DNA fragments were labeled with digoxigenin (DIG) using a DIG High Prime DNA Labeling and Detection Starter Kit II (Roche), and signals were detected according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression was quantified in technical triplicates using RT-qPCR performed in 384-well plates on a Roche LightCycler 480 Instrument II with dual hybridisation probes from The Universal ProbeLibrary (Roche). Oligonucleotide sequences used for RT-qPCR are listed in Appendix Table S3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pelleted tissue was weighted and resuspended in the enzymatic digestion mix composed by 2,4 U/ml dispase II (4 ml/g of muscles) (Roche 04942078001) dissolved in Dulbecco’s phosphate buffered saline (D-PBS ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using the LightCycler 480 Probe Master Kit and the LightCycler 480 II system (Roche Applied Science) as described previously92 ...
-
bioRxiv - Microbiology 2020Quote: ... HBsAg and HBeAg were measured using Elecsys HBsAg II (cobas) and Elecsys HBeAG (cobas) by cobas e 411 analyzer (Roche).