Labshake search
Citations for Roche :
1151 - 1200 of 6811 citations for Recombinant Human Collagen Type II Alpha 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... 10 ul of purified bacmid were resuspended in 130 ul Sf-900 II media with 10 ul X-treme XP transfection reagent (Roche # 06366236001) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Plant Biology 2019Quote: ... The probes were labeled with digoxigenin (DIG) according to the manufacturer’s protocol (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche, Basel, Switzerland). Northern blot procedures were performed as previously described (Jiang et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... were used as templates to synthesis DIG-labeled probes according to the manufacturer’s protocol (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche, Basel, Switzerland). ULTRAhyb®-Oligo Hybridization Buffer (Ambion ...
-
bioRxiv - Genetics 2021Quote: ... UK) following the manufacturer’s instructions and endpoint genotyping was conducted from fluorescence using a Lightcycler 480 Instrument II (Roche, Indianpolis, IN). The Rht markers were coded as lines with Rht-B1b (1) ...
-
bioRxiv - Plant Biology 2021Quote: ... and NADP-ME3 (Zm00004b015828) were quantified via qRT-PCR using a Roche Light Cycler 480 II using Roche SYBR green I (Roche 04707516001). The delta cT method was used to quantify relative gene expression of PEPCK1 and NADP-ME3 over time ...
-
bioRxiv - Immunology 2021Quote: ... The transcripts for genes of interest were measured by real-time PCR with a Lightcycler 480 II system (Roche, Basel, Switzerland) and a Brilliant III SYBR Green Master mix (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... A grid of slits was cut into the skin sheets to aid enzymatic access and the skin was then treated with 2U/ml dispase II (Roche, 04942078001) in RPMI at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: The cellular metabolic viability was measured by NADH-dependent mitochondrial dehydrogenase activity using Cell Proliferation Kit II (XTT) (Roche, Basel, Switzerland) according to the manufacturer’s protocol by measuring the absorbance at 492nm in BioTek Synergy HTX multimode reader ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Physiology 2023Quote: ... The qPCR program was initiated at 95°C for 10 minutes to denature the cDNA and activate the TAQ polymerase enzyme in a thermocycler (Lightcycler® 480 II Roche thermocycler ...
-
bioRxiv - Biophysics 2024Quote: ... cells were imaged using FLUOVIEW FV3000 confocal laser scanning microscope (Evident) and then lysed with BIORUPTOR II (BM Bio) in 1xPBS supplemented 1x cOmplete™ Protease Inhibitor Cocktail (Roche) in Protein LoBind Tubes (Eppendorf) ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Cell Biology 2020Quote: ... The ATP concentration of each sample was measured using a bioluminescence assay kit (ATP Bioluminescence Assay kit HTS II; Roche, Indianapolis, IN). Light emitted as a result of the reaction between D-luciferin and luciferase was detected using a 96 well micro-injector plate reader (POLARstar OPTIMA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was performed in 96-well plates with a final volume of 20 μl.The thermal melting curve were monitored using a LightCycler 480 II Real-Time PCR System (Roche Diagnostics, Rotkreuz, Switzerland) with a ramp rate of 1 °C at the temperature range from 25 °C to 80 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... Tongues were removed and injected beneath the lingual epithelium with 0.2 mL enzyme solution (3 mg Dispase II, 0.7 mg collagenase B (Roche diagnostics, Indianapolis, IN, USA) and 1 mg Trypsin Inhibitor in 1mL Tyrode’s) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The immunoprecipitated chromatin was purified by phenol-chloroform extraction and quantitative PCR was performed using Rotor-Gene 3000 cycler (Corbett) or LightCycler 480 II (Roche, Mannheim, Germany). Values were expressed relative to the signal obtained for the immunoprecipitation with control IgG ...
-
bioRxiv - Plant Biology 2020Quote: ... washing and detection were performed according to instructions of the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany).
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR of the RT cDNA was performed according to the manufacturer’s instructions in a LightCycler 480 II (Roche Life Science using SYBR GREEN (Roche Life Science, #04707516001) with a 10 μL total reaction volume ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR was performed based on SYBRgreen I technology using the ORA qPCR Green ROX L Mix (HighQu, Kraichtal, Germany) on a LightCycler 480 II 384 format system (Roche, Basel, Switzerland). For all primer pairs an annealing temperature of 60°C in a 3-step protocol was used ...
-
bioRxiv - Cell Biology 2020Quote: ... The thermofluor assay and calculation of melting temperatures were performed on a LightCycler® 480 II using LightCycler® 480 Software (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The qRT-PCR analysis was performed with the oligonucleotide primers listed in STAR Methods and SYBR Green I Master reagents with a LightCycler® 480 Instrument II (Roche Diagnostics). The final volume was 5 µL in a 384-well plate ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using the 5x HOT FIREPol® EvaGreen® qPCR Supermix (Solis Biodyne) and the LightCycler 480 II instrument (Roche). For RT-qPCR ...
-
bioRxiv - Bioengineering 2019Quote: ... Hybridization and washing were performed according to the procedures of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannhein, Germany). The membranes were imaged using UVP software.
-
bioRxiv - Molecular Biology 2019Quote: ... and the operating procedures according to the protocol supplied by the manufacturer of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany). The prober primes are shown in supplementary (Table S3).
-
bioRxiv - Biochemistry 2020Quote: ... Ganglia were mechanically disrupted with a pipette tip until obtaining a single cell suspension in culture media supplemented with DNAse I grade II at final concentration 3mg/ml (Roche, Cat# 104159), which was centrifuged at 1300 rpm (302 rcf ...
-
bioRxiv - Synthetic Biology 2020Quote: ... SYBR Premix Ex Taq (Tli RNaseH Plus) was used for qRT-PCR on a LightCycler 480 II thermal cycler system (Roche, Mannheim, Germany). 16S rRNA gene was selected as internal standard.
-
bioRxiv - Cell Biology 2020Quote: ... Southern blotting was performed as instructed in the instruction manual for the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche Cat. 11585614910).
-
bioRxiv - Cancer Biology 2021Quote: ... Femurs were then decalcified and paraffin sections (5-μm thickness) were stained with hematoxylin and eosin or reticulin (Reticulum II Staining Kit, Roche, Tucson, AZ) to assess fibrosis ...
-
bioRxiv - Microbiology 2021Quote: ... A single sample (one mouse) was assessed on each array plate on a Roche Light Cycler 480 II real time PCR thermal cycler (Roche, Basel, Switzerland). All data were analyzed with Qiagen’s Gene Globe online analysis application ...
-
bioRxiv - Genetics 2020Quote: ... The membrane was hybridized using digoxigenin-labeled DNA probes (S4 Table) for mPSP based on the DIG-High Prime DNA Labeling and Detection Starter Kit II protocol (Roche, Mannhein, Germany). For western blotting ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the HOT FIREPol® EvaGreen® qPCR Supermix (Solis BioDyne) and the LightCycler 480 II instrument (Roche). For RT-qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... The enrichment of specific target DNA sequences and controls in the immunoprecipitated material vs the input was determined by quantitative PCR (qPCR) using the HOT FIREPol® EvaGreen® qPCR Supermix (Solis BioDyne) and the LightCycler 480 II instrument (Roche). The primers used are listed in Table S2.
-
bioRxiv - Cell Biology 2023Quote: ... 60 and 90 mins post glucose load from tail vein blood using a glucose monitor (Accu-check Performa II, Roche Diagnostics, Australia). Insulin levels during the oral glucose tolerance test (Basal ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the time-dependent consumption of polyP using the TBO method (see above) and (ii) the hexokinase/glucose-6-phosphate dehydrogenase (Roche, Basel, Switzerland)-coupled NAD+ reduction process (λ340 nm ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT– PCR) was performed in optical 96-well plates via the LightCycler 480 II system (Roche Life Science) using KOD SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR was performed using gene-specific primers (Supplemental Table S3) using Promega Go Taq® qPCR Master Mix on a Light Cycler 480 II® (Roche) thermocycler ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM EDTA, 1 mM EGTA, 10% glycerol, 1% Triton X-100, 1 mM DTT, 1 mM PMSF, 1× Roche protease inhibitor cocktail) and about 500 μL of 0.5-mm-diameter glass beads ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative RT-PCR (qRT-PCR) reaction was performed using cDNA with SYBR green fast mix (Quantabio, PerfeCTa, 95072-012) on a Roche lightcycler (Roche, LightCycler 480 II). The following primers used for qRT-PCR ...
-
bioRxiv - Immunology 2021Quote: ... Ct values for Asns and the housekeeping gene Actb (Beta-actin) were determined by quantitative real-time PCR on a LightCycler® 480 II Real-Time PCR System (Roche Life Science), using the TB Green™ Premix Ex Taq™ (Takara ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene concentrations in purified genomic DNA extracts were quantified using SYBR Green I Master on a LightCycler 480 II (Roche Molecular Systems, Inc.). The primer pairs for Bacteria and Archaea were Bac908F_mod (5’ s-AAC TCA AAK GAA TTG ACG GG-3′ ...
-
Dissemination of linezolid-resistance through sex pheromone plasmid transfer in Enterococcs faecalisbioRxiv - Microbiology 2019Quote: ... blots were hybridized with digoxigenin (DIG)-labeled optrA-specific probe using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Sciences, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... Quantification of the mRNAs of interest was carried out on a Roche Lightcycler™ 480 II instrument by using SYBR-Green I Master mix (Roche, Basel, Switzerland) and primers specified in the Table bellow ...
-
bioRxiv - Microbiology 2021Quote: ... tissue pieces were incubated with their epidermal side facing up in RPMI 1640 medium supplemented with 2.4 U/ml Dispase II (Roche Diagnostics GmbH, Mannheim, Germany) overnight at 4°C ...