Labshake search
Citations for Roche :
951 - 1000 of 7383 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 μg of RNase A (Roche) per mg of cross-linked complex and incubated at 52 °C for 2 h ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg anti-GFP antibody (Roche#11814460001) was coupled to 50 µl Protein G Dynabeads slurry (Thermofisher#10612D ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 μL/mL Transferrin (Roche 10652202001). BMP4 was used at 10 ng/ml for iPSC differentiation ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs or HEK293T cells were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Genomics 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) supplemented with fresh protease inhibitors (AEBSF, Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Emulsions were snap-frozen in droplets in liquid nitrogen and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Vero/TMPRSS2 cells (JCRB Cell Bank, Cat# JCRB1818) were cultured in DMEM containing 5% FBS and 1 mg/mL G418 (Roche, Basel, Switzerland). VeroE6/TMPRSS2 cells (JCRB Cell Bank ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were brought to room temperature and washed twice in TNT before being incubated in blocking buffer (TNT+5% sheep serum+1% Roche blocking reagent) for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was isolated by isopropanol precipitation of cells and tumor lysates (lysis buffer was Tris [pH 8] 100 mM, EDTA 5 mM, SDS 0.2%, NaCl 200 mM, and 1 mg/mL proteinase K [Roche Diagnostics, Mannheim, Germany]) and resuspended in Tris/EDTA (TE ...
-
bioRxiv - Microbiology 2023Quote: ... Each membrane was incubated with rat anti-HA primary antibody (Sigma 11867423001; clone 3F10, monoclonal from Roche, 1:5000 in 5% milk) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... ESCs or HEK293T cells were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Cell Biology 2022Quote: ... in 5% non-fat dry milk in TBS/0.1% Tween-20 (TBST) or in 1% Western blocking reagent (WBR) (Roche Applied Science, Germany) in TBS (for β-actin) ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were lysed in 1% Triton X-100 (20 mM Tris [pH 7], 150 mM NaCl, 5 mM MgCl2) containing protease inhibitor (Roche, Cat# 11697498001) with end-over-end rotation for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Plant Biology 2024Quote: ... The membranes were blocked in 5% (w/v) nonfat dry milk and probed with anti-HA antibodies (Roche 11867431001; 1:10,000 dilution), followed by horseradish peroxidase-coupled secondary anti-rat antibody (Sigma-Aldrich A9037 ...
-
bioRxiv - Biochemistry 2024Quote: ... Membranes were blocked in 5% milk in PBS with 0.001% Tween-20 (PBST) before incubation with the specified antibodies prepared in 5% milk (GFP (Roche, 11814460001, 1:1,000), FLAG-HRP (Merck ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 0.1% NP-40, and protease inhibitor cocktail [Roche]). Then ...
-
bioRxiv - Developmental Biology 2024Quote: ... animals were incubated in MABTw blocking solution (5% heat-inactivated horse serum, 5% Roche Western Blocking Buffer in MABTw) for 2 hours at room temperature and then incubated in anti-DIG-AP (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... hydrated through an alcohol series and boiled in CC1 (citric acid buffer, Roche Diagnostics, Basel Switzerland) for 1 hour (pH 6 ...
-
bioRxiv - Genomics 2020Quote: ... concentrators and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 10X (2.5 ml ...
-
bioRxiv - Microbiology 2020Quote: ... or the MagNA Pure LC Total Nucleic Acid Isolation Kit (Cat. 03038505001, Roche Diagnostic, Basel, Switzerland) following the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2021Quote: ... as described by (18)) with supplemented ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (Roche Diagnostics), 1 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extraction was performed using the MagNA Pure Compact DNA Isolation Kit I (Roche Diagnostics) on the MagNA Pure LC automated extractor ...
-
bioRxiv - Microbiology 2021Quote: ... Total nucleic acid was extracted from samples with the MagNA Pure 96 system (Hoffmann-La Roche) using the MagNA Pure 96 DNA and Viral NA Small Volume Kit and eluted in a volume of 50μl Roche Tris-HCl elution buffer ...
-
bioRxiv - Immunology 2020Quote: ... viral RNA was isolated from plasma using a MagNA PureCompact Nucleic Acid Isolation kit (Roche Diagnostics). Real-time RT-PCR was performed using a QuantiTec Probe RT-PCR kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were purified from whole blood or serum using the MagNA Pure 96 system (Roche) with the DNA/Viral NA 2.0 kit and the Viral NA Plasma external lysis S.V ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... The genomic DNA was extracted from pools using High Pure Viral Nucleic Acid Kit (Roche, Germany) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... and viral genomes were purified with the High Pure Viral Nucleic Acid kit (Roche, Mannheim, Germany). Genome quantification of DENV ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 tetrazolium]-bis(4-methoxy-6-nitro)-benzene sulfonic acid hydrate (XTT)-based colorimetric assay (Roche) according to manufacturer-recommended protocols ...
-
bioRxiv - Microbiology 2020Quote: ... bacteria were harvested by centrifugation at 6,000 g for 10 min at 4°C and resuspended in L Buffer (25 mM Tris-HCl, 500 mM NaCl, 10 mM Imidazole, 1 mM PMSF, 5 % Glycerol, pH 8, containing Roche protease inhibitor cocktail). Bacteria were then lysed by sonication ...
-
bioRxiv - Cell Biology 2021Quote: ... along with the appropriate antibody (mouse HA 12CA5, 7.5 μl 0.4 mg/ml, Roche; mouse M2 FLAG, 5 μl 1 mg/ml, Sigma), before incubating at 4 °C on a rotating wheel at 14 rpm for 15-18 h ...
-
bioRxiv - Neuroscience 2022Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 5 mM EDTA, 50 mM NaF, 1 mM PMSF supplemented with Roche 1X Halt Protease inhibitor cocktail), incubated for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested and lysed using immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Approximately 1.5 mg of lysate from each sample was incubated with brachyury antibody at 4°C for 4 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pooled together and resuspended in 1.5 mL immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Cells were then incubated for 30 minutes on ice prior to centrifugation at high speed (15,000 rpm ...
-
bioRxiv - Immunology 2020Quote: ... at 37° C 5% CO2 in 96 well plates in the presence of IL2 (GIBCO 100 IU/mL or Roche 1 ng/mL). Additional conditions included 1 ng/mL TGFβ (GIBCO) ...
-
bioRxiv - Biochemistry 2023Quote: ... then lysed in ice-cold NP-40 lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol, Roche cOmplete protease inhibitor cocktail) by trituration followed by incubation on ice for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...