Labshake search
Citations for Roche :
801 - 850 of 3681 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... All PCR products were purified by the High Pure PCR Product Purification Kit (Roche) before being used for TAR cloning.
-
bioRxiv - Neuroscience 2022Quote: QRT-PCR was performed using a SYBR Green I real-time PCR method (Roche, LightCycler® 480 SYBR Green I Master ...
-
bioRxiv - Immunology 2022Quote: ... PCR reactions were performed on the LightCycler® 480 Real Time PCR System (Roche) using the FastStart SYBR Green Master Mix (Roche) ...
-
bioRxiv - Immunology 2019Quote: ... PCR reactions were performed on the LightCycler® 480 Real Time PCR System (Roche) using the FastStart SYBR Green Master Mix (Roche) ...
-
bioRxiv - Genetics 2020Quote: ... The inverse PCRs were performed with the expand long template PCR system (11681842001, Roche) using 30 amplification cycles (94°C 2 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... eight independent PCRs were performed using the Expand Long Template PCR System (Roche, 11759060001) that were subsequently pooled and purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... and iii) indexing PCR (KAPA HiFi HotStart ReadyMix PCR Kit, Roche, cat. no. KK2601). Sequencing was performed on a single Illumina NextSeq run (NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR products were purified with the High Pure PCR Product Purification Kit (Roche) before being used for TAR cloning.
-
bioRxiv - Developmental Biology 2022Quote: ... PCR reactions were performed on a LightCycler 480 II Real Time PCR Instrument (Roche) and analyzed using LightCycler 480 Software ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed by adding 10μl 2×HiFi PCR mix (Kapa Biosystems, Cat. 7958927001) and 0.5μl 60mM SINGV6 primer and running the following program ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR was performed with Roche LightCycler 480 Real Time PCR system (Roche, Switzerland) using LightCycler 480 SYBR Green Master (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR products were purified by the High Pure PCR Product Purification Kit (Roche) before TAR cloning.
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified with a PCR clean-up kit (Roche Applied Science) and end-labelled with T4 polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantitative PCR (qRT-PCR) was performed using Light Cycler 480 instrument (Roche Life Sciences). Anti-Flag® M2 affinity agarose gel was from Sigma-Aldrich (A2220) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified with the High-Pure PCR Product Purification kit (Roche) and the library was sequenced by Illumina X ten platform.
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified with the High-Pure PCR Product Purification kit (Roche) and then sequenced by the X ten platform.
-
bioRxiv - Cell Biology 2023Quote: ... we used PCR with a proofreading Taq polymerase (Roche, Expand Long Template PCR System) to amplify the C-terminal region (∼0.5-1 kb ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was conducted on Roche Lightcycler 96 Real time PCR system (Roche) with FastStart Essential DNA Green Master (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The real time PCR program of the quantitative PCR (LightCycler480 II, Roche, Basel, Switzerland) was arranged as follows ...
-
bioRxiv - Pathology 2023Quote: Quantitative PCR (qPCR) was performed using the Quantitect SYBR green PCR Master mix (Roche) with 10 ng of DNA and 0.5 μM primers in a final volume of 10 μl ...
-
bioRxiv - Microbiology 2024Quote: ... and 8 to 10 PCR cycles with the KAPA HiFi PCR kit (Kapa Biosystems) were used for amplification ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: ... 0.18 μM of each primer and 0.04 mg of Bovine Serum Albumin Fraction V (Roche), with the following thermal protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). Cq values of non-housekeeping genes were normalized to RHOA or b-ACTIN expression ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5 µM of each primer and 2x KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, MA). Each 16S rRNA gene amplicon was purified using the AMPure XP reagent (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR reactions (0.5 μl cDNA, 0.2 μM each primer, SYBR green Master Mix (Kapa biosystems) were performed on a Roche LightCycler 480 Real-Time PCR detection system ...
-
bioRxiv - Cell Biology 2022Quote: ... Intron-spanning primers were designed using the Universal Probe Library (UPL) Assay design centre (Roche). Primer sequences and UPL probes were total SNCA F-tgggcaagaatgaagaaggagc ...
-
bioRxiv - Genomics 2022Quote: ... to assess their size distribution and quantified by qPCR with adapter-specific primers (Kapa Biosystems). Libraries were pooled together based on expected final coverage and sequenced across multiple flow cell lanes to reduce the effect of lane-to-lane variations in yield ...
-
bioRxiv - Immunology 2022Quote: ... RNA concentrations were measured and cDNA was synthesized using random primers (Roche cat. no. 11034731001) and M-MLV reverse transcriptase (Invitrogen cat ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). RHOA expression was used as a housekeeping gene for the normalization of non-housekeeping gene expression ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... qPCR was performed using primers listed below with KAPA Sybr green master mix (Kapa biosystems) on ViiA7 Real-time pcr system (ABI) ...
-
bioRxiv - Cell Biology 2021Quote: ... The TaqMan primer sequences and associated universal probes were generated using ProbeFinder (version 2.53, Roche). The primers themselves were ordered from IDT ...
-
bioRxiv - Immunology 2020Quote: ... using V gene-specific primers 18 and KAPA Biosystems (KAPA HiFi HotStart, Roche, Basel, Switzerland). The PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was reverse transcribed using a mixture of oligo dT and random hexamer primers (Roche). Quantification was performed on a Light Cycler 480 using SYBR Green (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse primers included a promoter for in vitro transcription using SP6 RNA polymerase (Roche RPOLSP6RO) with incorporation of UTP-digoxigenin (Roche 11093274910) ...
-
bioRxiv - Genomics 2023Quote: ... We then build libraries using customized NextSeq primers and Kapa HiFi HotStart ReadyMix (Roche, 07958927001). Libraries were sequenced on an Illumina HiSeq 4000 with paired-end reads of 50 bases.
-
bioRxiv - Neuroscience 2023Quote: ... These primers were used in reactions with LightCycler® 480 SYBR Green I Master (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... These primers were used in reactions with LightCycler® 480 SYBR Green I Master (Roche).
-
bioRxiv - Synthetic Biology 2024Quote: ... was amplified using F3 and R3 primers (Supp. Table 2) and KAPA-Hifi polymerase (Roche). Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche #06402712001). Cq values of genes of interest were normalized to housekeeping gene RHOA expression.
-
bioRxiv - Immunology 2021Quote: ... All reactions were carried out in a LightCycler 96 System and the fluorescence threshold limit of the probe was automatically set by LightCycler software (Roche). The results were represented as the ΔCt between ZIKV and RNAase P amplification.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The qPCR reactions were set up in 20 μL using LightCycler® 480 SYBR Green I Master 2x (Roche, Germany), 300 nM of oligonucleotides and 1:10 dilutions of each cDNA with three replicates per sample ...
-
bioRxiv - Genetics 2021Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2019Quote: ... and quantitative PCR (KAPA Biosystems). The libraries were clustered on 2 lanes of a flowcell then loaded on the Illumina HiSeq instrument according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and quantitative PCR (Kapa Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative PCR (Kapa Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2021Quote: ... and quantitative PCR (KAPA Biosystems).
-
bioRxiv - Genomics 2021Quote: ... and quantitative PCR (KAPA Biosystems).
-
bioRxiv - Genetics 2020Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturer’s instructions ...