Labshake search
Citations for Roche :
801 - 850 of 1015 citations for Recombinant Human Aldehyde Dehydrogenase 3 Family MemberA1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (3–4 μg) was used to prepare cDNA with the Transcriptor First-Strand cDNA synthesis kit (Roche). qPCR was performed with TaqMan gene expression assay primers (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin-embedded human intestinal tissues was carried out on a Discovery Ultra automated slide stainer using a rabbit anti-human monoclonal antibody for CEA (Clone T84.66, Roche Glycart AG, Switzerland) at 2.23 µg/ml after antigen retrieval with Cell Conditioning 1 (CC1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... The cytotoxic potential of the samples was determined from THP1-cell supernatants after 3 hours by using the Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... lungs were removed and single-cell suspensions of lung mononuclear cells were prepared by Liberase Blendzyme 3 (70 ug/ml, Roche) digestion containing DNaseI (30 µg/ml ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL / well of MTT (3- [4,5-dimethylthiazol-2-yl] −0,5-diphenyl tetrazolium bromide (11465007001; Roche Life Science, Mannheim, Germany) labeling reagent (1× ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Biochemistry 2020Quote: ... The thorax and the abdomen were then washed with 3 ml of pre-chilled 0.1 M KBP pH 7.4 homogenization buffer (HB) containing 1x protease inhibitor (Roche Complete ULTR). The complex was homogenized in 20 ml of HB using 40 ml glass Dounce homogenizer with a loose B pestle (Wheaton Science ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to the 3-4 ml of digestion media containing 0.1 mg/ml liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... 60 μl of anti-mouse magnetic beads were washed PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche) or Anti-Rpb3 antibodies (Neoclone ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... Pellets were resuspended by bead beating for 5 min in 100 μL TE supplemented with 3 mM and 1x protease inhibitors (Roche) with 100 μL acid-washed glass beads ...
-
bioRxiv - Cell Biology 2022Quote: Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
bioRxiv - Neuroscience 2022Quote: Mounted coronal cryosections were rinsed in PBS for 3 times (5 min) and thereafter incubated in Blocking Reagent (Roche Diagnostics) for 15 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Developmental Biology 2022Quote: ... Signal was revealed with 4 μL of NitroBlue Tetrazolium/5-Bromo-4-Chloro-3-Indolyl Phosphate (NBT/BCIP) Stock Solution (Roche)/ml of AP reaction buffer ...
-
bioRxiv - Microbiology 2021Quote: ... after lysis of the insect cell pellet by 3 cycles of freeze-thaw in the presence of Complete protease inhibitor cocktail (Roche), and removal of debris the lysate was loaded onto a 20-40% sucrose density gradient ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Genetics 2022Quote: ... Expression patterns were visualized with a Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3-Indolyphosphate p-Toluidine Salt (NBT/BCIP) system (Roche). Sections were mounted with Vectamount (Vector laboratories ...
-
bioRxiv - Genomics 2019Quote: ... The dry contents were resuspended by addition of 7.5 µl hybridization buffer and 3 µl hybridization component A (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), mixed by tapping ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Protein extracts were incubated for 3 h on a spinning wheel at 4°C with 40 µl of Protein G Sepharose beads (Roche) and 2.5 µg of the specific BTV-NS3 antibody ...
-
bioRxiv - Molecular Biology 2019Quote: ... and viability was measured using the Roche MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) kit (Roche, Cat # 11465007001) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: BAL was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml PBS with 0.1% BSA and protease inhibitor cocktail tablets (Roche, Indianapolis, IN). Animals were then perfused with PBS before tissue collection ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 pmol of the forward and reverse gene-specific primers each (Supplemental Table 3) in Light Cycler SYBR Green I Master mix (Roche) on LightCycler 480 II (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... They were then blocked in PBS with 3% BSA for 3h at RT and incubated overnight at 4°C with a peroxidase-labeled anti-DIG antibody (Roche) diluted 1:1500 in PBS with 3% BSA ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then incubated at room temperature in the same solution containing NBT-BCIP (nitrotetrazolium blue chloride at 350 µg/ml and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt at 175 µg/ml) (Roche) until the color appeared ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time quantitative PCR reactions from 8,3 ng of cDNA were set up in triplicate using a LightCycler DNA SYBR Green I Master PCR machine (Roche). The oligonucleotides used in qRT-PCR experiments are provided in SI6.