Labshake search
Citations for Roche :
551 - 600 of 1015 citations for Recombinant Human Aldehyde Dehydrogenase 3 Family MemberA1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... collected in a 1.5 ml tube and blocked overnight in 3% BSA (Roche) before incubating in primary antibody (3% BSA in PBT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 with with 2X cOmplete Protease Inhibitor Cocktail EDTA-free (Roche)) for 8 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... Following re-suspension in 3 ml of medium containing protease inhibitor (Roche Diagnostics), the cells were cracked open using a ball bearing homogenizer with a 0.2507-inch bore and 0.2496-inch diameter ball ...
-
bioRxiv - Immunology 2019Quote: ... Single-cell suspensions of lung cells were prepared by Liberase Blendzyme 3 (Roche) digestion of perfused lungs as previously described48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Mannheim, Germany Cat#11383221001) was used in conjunction with nitro blue tetrazolium (NBT ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Genomics 2019Quote: The gDNA libraries were prepared using a SeqCap EZ Human Exome Library v2.0 (Roche, Basel, Switzerland). Sequencing was performed with 100-bp paired-end reads by the HiSeq2000 sequencer (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library (UPL) Probefinder software for human (Roche, version 2.53) or using previously published sequences and adjusted to be intron-spanning ...
-
bioRxiv - Immunology 2019Quote: For the in vitro cell stimulation and maintenance reagents were as follows: human IL-2 (Roche); IL-21 (PeproTech) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used for the immunostaining include human ERα rabbit monoclonal antibody (Roche Diagnostics, 790-4325), human PR rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regions to sequence were selected with the SeqCap EZ Human Exome Library v3.0 (Roche Applied Science) according to the manufacturer’s instructions and underwent 2 × 151 base-pair sequencing on Hiseq 4000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... human skin was cut into thin pieces and incubated overnight at 4°C with dispase (Roche) at 2.4 U/ml ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1-3 days in an NBT/BCIP (Roche, Cat No./ID: 11681451001) solution ...