Labshake search
Citations for Roche :
751 - 800 of 975 citations for Recombinant Human Aldehyde Dehydrogenase 3 Family MemberA1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to 3-4 ml of digestion media containing 0.1 mg/ml Liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myelin was washed by dilution in HBSS and centrifuged at 400 x g for 5 min at 4 °C before suspending in 3 mL ice cold 0.32 M sucrose solution containing protease inhibitor cocktail (Roche). Next ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (3–4 μg) was used to prepare cDNA with the Transcriptor First-Strand cDNA synthesis kit (Roche). qPCR was performed with TaqMan gene expression assay primers (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin-embedded human intestinal tissues was carried out on a Discovery Ultra automated slide stainer using a rabbit anti-human monoclonal antibody for CEA (Clone T84.66, Roche Glycart AG, Switzerland) at 2.23 µg/ml after antigen retrieval with Cell Conditioning 1 (CC1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... The cytotoxic potential of the samples was determined from THP1-cell supernatants after 3 hours by using the Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... lungs were removed and single-cell suspensions of lung mononuclear cells were prepared by Liberase Blendzyme 3 (70 ug/ml, Roche) digestion containing DNaseI (30 µg/ml ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL / well of MTT (3- [4,5-dimethylthiazol-2-yl] −0,5-diphenyl tetrazolium bromide (11465007001; Roche Life Science, Mannheim, Germany) labeling reagent (1× ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Biochemistry 2020Quote: ... The thorax and the abdomen were then washed with 3 ml of pre-chilled 0.1 M KBP pH 7.4 homogenization buffer (HB) containing 1x protease inhibitor (Roche Complete ULTR). The complex was homogenized in 20 ml of HB using 40 ml glass Dounce homogenizer with a loose B pestle (Wheaton Science ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to the 3-4 ml of digestion media containing 0.1 mg/ml liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... 60 μl of anti-mouse magnetic beads were washed PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche) or Anti-Rpb3 antibodies (Neoclone ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... Pellets were resuspended by bead beating for 5 min in 100 μL TE supplemented with 3 mM and 1x protease inhibitors (Roche) with 100 μL acid-washed glass beads ...
-
bioRxiv - Cell Biology 2022Quote: Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...