Labshake search
Citations for Roche :
7951 - 8000 of 8559 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... mouse thymus was collected and homogenized in 1 ml of cold PBS containing cOmplete protease inhibitor cocktail (Roche, Indianapolis, IN) using a tissue homogenizer (Omni International ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein extracted using RIPA buffer with protease inhibitor cocktail mix (1 Complete MINI EDTA-free protease inhibitor tablet (Roche), 25 μg/mL calpain inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50 mM NaCl, 50 mM sodium pyrophosphate, 50 mM sodium fluoride, 1% Triton-X-100, 10% glycerol, 5 mM EDTA, Roche MiniProtease Inhibitor cocktail tablet ...
-
bioRxiv - Neuroscience 2022Quote: ... and proteins were transferred to an activated (100% ethanol, 1 min; followed by two washing steps with water) PVDF membrane (Roche Diagnostics GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM TCEP 10 % v/v glycerol) supplemented with 4x EDTA-free protease inhibitor cocktail tablets (Roche, cat. No. 11836153001) and 4 μg/ml DNase I ...
-
bioRxiv - Developmental Biology 2022Quote: ... before being incubated in TNTw/block for 1 hour followed by an ON incubation with anti-DIG or anti-Fluo horseradish peroxidase (Roche). Post-antibody washes and the TSA reactions were repeated as for the first probe ...
-
bioRxiv - Cell Biology 2022Quote: ... Thawed pellets were resuspended with 200-300 µL native lysate buffer (1% NP-40 with 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche] ...
-
bioRxiv - Cell Biology 2022Quote: ... At the completion of the assay islets were lysed in RIPA buffer (Pierce) containing 1 mM PMSF and EDTA-free protease inhibitor cocktail (Roche)) at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Protein lysates were collected from worms using RIPA buffer (50 mM Tris-HCl, 250 mM sucrose, 1 mM EDTA, and Roche protease inhibitor tablet ...
-
bioRxiv - Biophysics 2022Quote: ... cells were gently washed twice with 500 μl cold PBS and directly lysed in 50 μl of lysis buffer (PBS, 1% (v/v) Triton X-100 and protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 1:500 for 32 min was used followed with the secondary antibody OmniMap anti-rabbit HRP (760-4311, Roche). Antigen-antibody complexes were revealed with ChromoMap DAB Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 ng of U1 RNA (TMG or NAD cap) and 150 ng of HIV-1 mRNA were mixed with ResoLight dye (1x, Roche) and annealing buffer (10 mM Tris ...
-
bioRxiv - Cancer Biology 2022Quote: ... The eluted chromatin was then treated with RNaseA (10mg/mL) for 1 hour at 37°C and with Proteinase K (Roche) for 2 hours at 55°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Both Caco2 and HepG2 cells were transfected with 1 µg of pooled plasmid using X-tremeGENE9 Transfection Reagent (Roche:6365779001) following manufacturer recommendations ...
-
bioRxiv - Genetics 2022Quote: ... 50000 cells were lysed in NPB buffer (PBS containing 5% BSA, 1mM DTT, 0.2% IGEPAL, 1□×_Roche Complete Protease Inhibitor) and incubated on ice for 15 min to isolate nuclei ...
-
bioRxiv - Genetics 2022Quote: ... COS-7 cells transiently expressing POPDC constructs with the appropriate epitope tag were lysed using a 1% (v/v) Triton X-100 based lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche). Lysates were subjected to Co-IP using the ProFoundTM c-Myc Tag IP/co-IP Kit (Thermo Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: Slides were blocked for two hours at room temperature in blocking buffer composed of 1% Roche blocking reagent (Roche #11096176001) and 20% sheep serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.25 µM forward and reverse primers (Extended Data Table 1) on a LightCycler 480/II 384 (Roche, serial #6073). Four technical replicates were performed per biological replicate qPCR primer set ...
-
bioRxiv - Microbiology 2022Quote: ... lacking the predicted signal peptide (amino acids 1-29) was amplified from genomic DNA (isolated using the High Pure Template kit, Roche) by PCR using the Phusion Hot start II High Fidelity DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... Sections after the post-hybridization washing and blocking steps were incubated with peroxidase-conjugated anti-digoxigenin sheep antibody (1:1000; 11207733910, Roche) in TS 7.5 containing 1% Blocking Reagent at 4°C for overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... were co-transfected with SAE2-T2A-SAE1 cDNA in the pcDNA5/FRT/TO vector and the Flp-recombinase cDNA in the pOG44 vector at a 5:1 pcDNA5/FRT/TO DNA: pOGG44 DNA ratio using FuGene6 (Roche) at a ratio of 4:1 FuGene (μl) ...
-
bioRxiv - Microbiology 2022Quote: ... Beads were then washed three times with 400 μL wash buffer (25 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA pH 8, cOmplete protease inhibitor cocktail (Roche), 5% glycerol) ...
-
bioRxiv - Microbiology 2022Quote: ... A cell pellet was resuspended in 250 μL Tris-EDTA buffer and 50 μL 30 g L-1 lysozyme (Roche) in Tris-EDTA buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 30 mM imidazole and 10 % (v/v) glycerol] supplemented with 1 mM PMSF and complete EDTA-free protease inhibitor cocktail (Roche). After centrifugation at 45 000 x g supernatant was filtered (0.45 µm ...
-
bioRxiv - Plant Biology 2022Quote: ... 10% [v/v] glycerol, 10 mM EDTA, 1% [v/v] NP-40, and complete EDTA-free protease inhibitor cocktail [Roche]). The extracts were centrifuged at 20,000 × g at 4°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: ... then ground in 500 μl freshly prepared lysis buffer (25 mM Tris HCl pH 8, 150 mM NaCl, 1% SDS, 1x cOmplete ULTRA protease inhibitor (Roche), and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were incubated with 8-keto-NeuAc derivatives for 24 h and proliferation measured using WST-1 (Roche Applied Science) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of total RNA from each sample was converted into cDNA with First Strand cDNA Synthesis Kit (Roche, #04897030001). Primers used in the RT-qPCR are listed in Supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... upon which cells were washed with 2x ice-cold PBS and lysed in RIPA buffer with 1× EDTA-free protease inhibitor cocktail (Roche). Lysates were then separated on a 17.5% acrylamide gel for 6h at 150V and transferred onto a 0.22µM nitrocellulose membrane using semi-dry transfer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each was lysed by trituration in 1 mL ice-cold PBS with 0.25% Triton-X containing cOmplete™ mini EDTA-free protease inhibitor cocktail tablet (Roche) at a concentration of 10% w/vol followed by a 15-minute incubation on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... Phosphorylated and annealed oligos were diluted 1:10 and a Golden Gate reaction was setup with 1x rapid ligase (Roche), 10 units of BbsI enzyme ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were washed in chilled 1X PBS and subjected to dounce homogenization in lysis buffer (5mM HEPES, 85mM KCl, 1% IGEPAL CA-630 in 1X PBS, 1X Roche Complete protease inhibitors ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell pellets were resuspended in 1 mL Equilibration Buffer B containing protease-inhibitor mix (Complete EDTA-free; 11 873 580 001, Roche) and 0.2 mg/mL lysozyme ...
-
bioRxiv - Plant Biology 2022Quote: ... with Horse Radish Peroxidase (HRP)-conjugated antibody (HRP-conjugated anti-HA antibody, 1/1000 [50 mg/mL], cat. no. 12013819001, Roche; HRP-conjugated anti-FLAG antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with an antibody against HA directly conjugated to HRP (anti-HA-HRP; Roche) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Different dilutions of the enzyme preparation were assayed for 1 hour and analyzed with a luciferin-luciferase coupled reaction (76) using the CLSII-Bioluminiscent ATP Assay Kit (Roche).
-
bioRxiv - Immunology 2023Quote: ... The cell pellets were treated with lysis buffer (50 µg/mL digitonin, 75 mM NaCl, 1 mM NaH2PO4, 8 mM Na2HPO4, 250 mM sucrose, and Roche cOmpleteTM protease inhibitor cocktail ...
-
bioRxiv - Plant Biology 2023Quote: ... Detection of alkaline phosphatase was carried out for ∼1 h using NBT/BCIP ready-to-use stock solution (La Roche) diluted in 1× washing buffer.
-
bioRxiv - Plant Biology 2024Quote: ... The transformants were screened on MS plants with 1% sucrose and 0.8% agar containing 40mg/L hygromycin (Roche, no. 10843555001). For each construct ...
-
bioRxiv - Biochemistry 2024Quote: ... the proteins were transferred to a PVDF membrane and immunodetected with an anti-Myc-HRP antibody (Myc-HRP, 1:5000, Roche). The remaining 10% of the immunoprecipitated samples together with 50 μg of the input were subjected to the same procedure but probed with an anti-GFP antibody (JL-8 ...
-
bioRxiv - Bioengineering 2024Quote: cDNA from cells was diluted 1:10 and qPCR was performed in triplicate using LightCycler 480 SYBR Green I Mastermix (Roche). Samples containing primers specific for lmna ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were blocked for 30 min and then incubated in an alkaline phosphatase conjugated anti-DIG antibody (1:600, Roche). Slides were then washed and developed overnight in BCIP/NBT chromogen (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA (1 μg) was reverse transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (catalog no. 04379012001, Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were disrupted in 1% NP-40 lysis buffer (140 mM NaCl, 10 mM Tris-HCl pH 8, 1% NP-40) supplemented with proteinase inhibitors (Roche). Proteins were separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membrane lysis was performed in 5Lml LB1 (50LmM HEPES pH 7.5, 140LmM NaCl, 1LmM EDTA, 10% glycerol, 0.5% 1% IPEGAL-CA630, 0.25% Triton X-100, and Roche protease inhibitors 11836170001) for 10 min at 4 °C with rotation ...