Labshake search
Citations for Roche :
7551 - 7600 of 8835 citations for FH1 FH2 domain containing protein 1 FHOD1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 mM EDTA and 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets Roche). Bacterial cells were lysed with a M110-P microfluidizer (Microfluidics ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hearts were cut into 1–2 mm3 pieces and incubated with 0.5 U/mL collagenase B (Roche #11088807001) in 0.2% NaN3/PBS and left to oscillate at 1000 rpm at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% Triton X-100) supplemented with 1X complete protease inhibitor cocktail and 1X complete phosphatase inhibitor cocktail (Roche) using a Precellys Evolution homogenizer (Bertin Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Plant Biology 2023Quote: ... cells were ruptured by bead beating in lysis buffer (50 mM Tris-pH 8.0, 1 mM DTT, 0.5 mM PMSF and 2x PhosStop EASYpack-Roche) for 7 cycles with 30 seconds of beating at 400 rpm and 45 seconds on ice for each cycle ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used in this study and their respective dilutions were: mouse monoclonal anti-GFP at 1/1000 (clones 7.1 and 13.1, Roche), mouse monoclonal anti-TY at 1/200 (53) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the mixture was resuspended in buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were washed three times (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-7 washing steps with wash buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and ½ tablet of proteinase inhibitor cocktail, Roche 11836170001) were performed before the beads were either sent for mass spectrometry or prepared with the appropriate amount of SDS for SDS/PAGE and Western blot ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used in this study and their respective dilutions were mouse monoclonal anti-GFP at 1/1000 (clones 7.1 and 13.1, Roche), mouse monoclonal anti-TY at 1/250 (53) ...
-
bioRxiv - Biochemistry 2023Quote: ... 30% glycerol [w/vol] and bromophenol blue) and 1 µl of proteinase K (14–22 mg/ml, Roche) and incubating at 37 °C for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... at 95°C for 60 minutes or with a medium concentration of protease (Protease 1; Roche Tissue Diagnostics) for 4 minutes ...
-
bioRxiv - Microbiology 2022Quote: Cells were washed once with 1xPBS before harvesting in NP-40 buffer with protease inhibitor (200 mM NaCl, 50 mM Tris pH 7.4, 0.5% NP-40 Alternative, 1 mM dithiothreitol, and Roche Complete Mini ...
-
bioRxiv - Molecular Biology 2022Quote: ... Asokoro Abuja using the COBAS AmpliPrep/COBAS TaqMan HIV type 1 (HIV1) v2.0 test (Roche Diagnostics, Basel, Switzerland). Whole genome sequencing of 61 blood samples was performed according to the Bonsall et al protocol10 ...
-
bioRxiv - Cell Biology 2022Quote: ... the chromatin pellet was suspended with buffer B (20 mM Tris-HCl, pH 8.0, 0.5 M NaCl, 10 mM EDTA, and 1× complete protease inhibitor cocktail; Roche), and then mononucleosome was extracted ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed with 1 μg of DNA and KAPA HTP Library Preparation Kit (KAPA Biosystems, #KK8234). Resulting reads (50 base single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 50 mM sodium fluoride, protease inhibitors [Roche]). Triton X-100 (0.1% ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 5% glycerol, 1x protease/phosphatase inhibitor cocktails, Roche). Nuclear lysates were diluted with 2 volumes of dilution buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM PMSF) and supplemented with a protease inhibitor cocktail (cOmplete Protease Inhibitor Cocktail Tablets, EASYpack, Roche). Cells were lysed by sonication on ice (Branson Digital Sonifier 450 ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated by lysing cells (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.67% SDS, and 125 μg/ml proteinase K from Roche), followed by incubation 4 hours at 55°C with weak agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20% v/v glycerol, 2 mM MgCl2, 0.5 mM EDTA, 0.2% NP40, 1 mM DTT, 1x Complete Protease inhibitors, Roche) and the suspension tumbled at 4 °C for 45–75 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... resuspended in buffer A complete (buffer A with 0.15% NP40, 0.5 mM DTT, 1 x Complete protease inhibitors, Roche), and dounced 40 times ...
-
bioRxiv - Molecular Biology 2024Quote: Site directed mutagenesis of plasmids listed in Table 1 was carried out using KAPA HiFi HotStart premix (Roche) or Tks Gflex DNA polymerase (Takara Bio ...
-
bioRxiv - Genomics 2024Quote: ... Cell pellets were resuspended in 250 µL ice-cold Hi-C lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630, 1 tablet/10 mL Roche complete mini EDTA-free protease inhibitor) ...
-
bioRxiv - Immunology 2024Quote: ... the cell pellet was re-suspended and incubated in 1 ml of Red Blood Cell Lysis Buffer (Roche) for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... RNA was harvested by removal of culture medium and addition of 200 µl of 1 M DTT (Roche) supplement Kingfisher RNA lysis buffer (Thermofisher) ...
-
bioRxiv - Immunology 2024Quote: ... nuclei were resuspended in 1mL ST buffer (nuclear flow cytometry, RNAseq experiment 2) or PBS/1% BSA/0.2UμL Protector RNAse inhibitor (Roche) (RNAseq experiment 1) ...
-
bioRxiv - Microbiology 2024Quote: ... and subsequently resuspended in 1 mL of lysis buffer (0.5% NP40, 50 mM Tris–HCl pH 7.4; 150 mM NaCl, 1 mM EDTA, cOmplete protease (Roche) and PhosSTOP phosphatase (Roche ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Biophysics 2024Quote: ... A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems; 1-μL qPCR template, 15 cycles maximum). We amplified corresponding regions of pSC101_TetR_specR with primers that linearized the backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM DTT buffer to which was added 1 tablet of complete EDTA-free protease inhibitors cocktail (Roche). The cells were lysed by passage through an Avestin high pressure system at 45 psi ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was dried overnight and then lysed with glass beads in lysis buffer (Tris-HCl [pH 7.5], 1 mM EDTA, 2.75 mM DTT, protease inhibitor cocktail (cOmplete EDTA-free [Roche]). Next 3x SDS sample buffer (187.5 mM Tris [pH 6.8] ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclear pellets were resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 7.5, 1X Roche protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Bacterial pellets were collected via centrifugation at 4°C and 5,000g and resuspended in ice-cold lysis buffer (50 mM MES pH 6.8, 1 mM EGTA, 0.2 mM MgCl2, 5 mM DTT, Roche complete protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed with 1 μg of purified RNA using Transcriptor First Strand cDNA synthesis KIT (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the striatal/accumbal slices were sonicated in 300 µL lysis buffer (50 mM Tris-HCl [pH 7.5], 1 mM EGTA, 20 mM MgCl2, 500 mM NaCl, 0.5% NP-40, protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cancer Biology 2023Quote: Orthotopically implanted syngeneic KPC3 tumor tissues were harvested and digested with 1 mg/mL Collagenase D (Roche, Switzerland) plus with 100 μg/mL DNase I (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA samples were separated on 1% agarose formaldehyde gels and transferred to Hybond-N membranes (Roche Molecular Biochemicals). Membrane hybridization was carried out overnight at 65°C using digoxigenin-labeled riboprobes corresponding to PVX CP sequences.
-
bioRxiv - Molecular Biology 2023Quote: ... and lysed in NP-40 buffer (150 mM NaCL, 1% IGEPAL, 50 mM Tris-Cl p.H. 7.5) with protease inhibitor (Roche #04693132001 ...
-
bioRxiv - Microbiology 2022Quote: ... Uninfected erythrocytes were removed using saponin buffer (0,1% saponin/PBS plus 1× cOmplete™ protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG was detected with anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche, Indianapolis IN; 1:2000 dilution). Alkaline phosphatase activity was revealed using NBT/BCIP (Roche ...