Labshake search
Citations for Roche :
701 - 750 of 816 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... Each cDNA sample was measured in duplicate using 3 μL of 4x diluted cDNA per 10 μL reaction in a LightCycler96 Instrument (Roche). qPCR parameters were set to 10 minutes of preincubation at 95 °C ...
-
bioRxiv - Microbiology 2023Quote: Brains of ICR mice mock- infected or infected ocularly with 3×106 PFU/eye of vUNG-S302A and vUNG-SA-repair were homogenized in TriPure isolation reagent (Roche) using a disposable pestle system (Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Pathology 2023Quote: ... Bound alkaline phosphatase was visualized with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; 11681451001, Roche). The reaction was stopped by incubation in buffer 4 (10 mM Tris and 1 mM EDTA ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted 1:10 in water and qPCR was performed with 3 μL of each diluted cell lysate using the LightCycler 480 Probes Master mix (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Positive controls were generated by incubating some sections from control 3 dpf animals with recombinant DNAse I (400 U/ml; Roche) for 20 minutes at room temperature before the incubation in the reaction mix ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Pathology 2023Quote: ... in HEK 293T cells (3×105 cells per well in 6-well plates) using X-treme gene transfection reagent (Roche). Pseudotyping was achieved by co-transfecting pHEF-VSVg (400 ng/well) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The signals were detected by 4-nitro-blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) in a humidified container for 72 h at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Developmental Biology 2024Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were isolated by carefully transferring the extracted parasite mixture on top of a 0.25 M to 0.1 M sucrose gradient in cell lysis buffer (10 mM Tris pH 8, 3 mM MgCl2, 0.2% NP-40, 1x EDTA free Protease inhibitor (Roche, 04693132001); 15 mL 0.25 M Sucrose and 17.5 mL 0.1M Sucrose for 50 mL tubes ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biochemistry 2019Quote: ... and the resulting duplex was captured on 3 mg streptavidin-coated magnetic beads (Roche, rotation for 2 h at 37°C). After extraction with phenol-chloroform and precipitation with ethanol ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...