Labshake search
Citations for Roche :
701 - 750 of 8815 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Wings were stained at room temperature for 4-6 h in BM Purple (Roche Applied Science).
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were stained with secondary antibodies (1:300) for 2 h at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). Cells were mounted with ProLong Diamond Antifade Mountant (Thermo P36970 ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Biophysics 2021Quote: ... Suspended membrane vesicles were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Immunology 2021Quote: ... slices were blocked for 30 min (2% BSA, 0.1ug/ul Salmon Sperm, 0.5% Saponin, 1 U/µl protector RNase inhibitor (Roche) in 3X SSC ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche] ...
-
bioRxiv - Neuroscience 2021Quote: ... The floating sections were then treated with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml, 10236276001; Roche Diagnostics) at room temperature for 20 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM MOPS, pH 7.2; 2 mM EDTA; 1 mM PMSF; 1X cØmplete, mini, EDTA-free protease inhibitor cocktail, Roche). Cells were lysed by bead beating with 0.5 mm glass beads for 3×20s at 6.5 m/s in a benchtop homogenizer (Fastprep-24 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM MOPS, pH 7.2; 2 mM EDTA; 1 mM PMSF; 1X cØmplete, mini, EDTA-free protease inhibitor cocktail, Roche). Cells were lysed by bead beating with 0.5 mm glass beads for 3×20s at 6.5 m/s in a benchtop homogenizer (Fastprep-24 ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 M PIPES-NaOH pH 6.9, 2 mM EGTA, 1 mM MgSO4, 0.1 mM EDTA, cOmplete protease inhibitors [Roche]) (5 min ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1 × protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 μl/10 mg) ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Genomics 2021Quote: ... 150 mM NaCl, 2 mM EDTA pH8, 1% NP-40, 0.5% Sodium Deoxycholate, 0.1% SDS, supplemented with ROCHE Complete protease inhibitor tablets (no EDTA) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 150 mM NaCl, 2 mM EDTA pH8, 1% NP-40, 0.5% Sodium Deoxycholate, 0.1% SDS, supplemented with ROCHE Complete protease inhibitor tablets (no EDTA) ...
-
bioRxiv - Biochemistry 2021Quote: ... 150 mM NaCl and 1 mM MgCl2) containing protease inhibitors (2 tablets EDTA-free protease inhibitor cocktail (Roche), 2.6 mg/L aprotinin ...
-
bioRxiv - Biophysics 2021Quote: ... Isolated membrane fractions were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.0, 20 mM KCl, 1 mM MgCl, 2 mM EDTA, pH 7.5 and protease inhibitor cocktail, Roche) from cells grown in EMM with appropriate glucose concentrations and with or without thiamine (5μg/ml) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with modifications - membranes were pre-hybridized in a volume of 0.2ml of pre-hybridization solution (5xSSC, 0.1% N-Lauroylsarcosine sodium salt, 1% SDS, 2% Blocking reagent (Roche)) for each 1cm2 of the membrane ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM EDTA and 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets Roche). Bacterial cells were lysed with a M110-P microfluidizer (Microfluidics ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hearts were cut into 1–2 mm3 pieces and incubated with 0.5 U/mL collagenase B (Roche #11088807001) in 0.2% NaN3/PBS and left to oscillate at 1000 rpm at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 2 mM EDTA, containing ‘Complete mix’ protease inhibitors from Roche) and passed 10 times through a 26-gauge needle ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20% v/v glycerol, 2 mM MgCl2, 0.5 mM EDTA, 0.2% NP40, 1 mM DTT, 1x Complete Protease inhibitors, Roche) and the suspension tumbled at 4 °C for 45–75 min ...
-
bioRxiv - Immunology 2024Quote: ... nuclei were resuspended in 1mL ST buffer (nuclear flow cytometry, RNAseq experiment 2) or PBS/1% BSA/0.2UμL Protector RNAse inhibitor (Roche) (RNAseq experiment 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM DTT buffer to which was added 1 tablet of complete EDTA-free protease inhibitors cocktail (Roche). The cells were lysed by passage through an Avestin high pressure system at 45 psi ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche) using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... The nucleus was stained with 4,6-Diamidino-2-phenylindole (DAPI, 1 µg/mL in PBS) (Roche; Basel, Switzerland). Finally ...
-
bioRxiv - Biophysics 2022Quote: ... Isolated membrane fractions were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Genomics 2023Quote: ... treated at 55°C and then pre-cleared with 1:2 KAPA Pure beads (Roche Cat. No: 07983298001). The quality and quantity of fragmented DNA were verified using agarose gel (1.5% ...
-
bioRxiv - Cell Biology 2024Quote: ... 300 mM NaCl, 3.0 mM MgCl2, 2 mM DTT, 0.2 % Triton X-100, 1 tablet cOmplete Mini, Roche) and 150 μL MQ ...
-
bioRxiv - Molecular Biology 2024Quote: ... then Lysis Buffer 2 (10 mM Tris-HCl pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1x Roche cOmplete™ ...
-
bioRxiv - Developmental Biology 2024Quote: ... were added to freshly prepared DB1 buffer (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5 mM spermidine, 2% glycerol, 1× EDTA-free with Roche complete protease inhibitor ...
-
bioRxiv - Developmental Biology 2022Quote: LC-MS-based quantification of methyl-cytosines was performed on 1 μg of DNA degraded to nucleosides with nuclease P1 (Roche), snake venom phosphodiesterase (Worthington ...
-
bioRxiv - Genomics 2022Quote: ... Samples were ground to powder in liquid nitrogen and then dissolved in 2 mL lysis buffer (8 M urea, 2% SDS, 1x Protease Inhibitor Cocktail (Roche Ltd. Basel, Switzerland), followed by sonication on ice for 30 min and centrifugation at 13 000 rpm for 30 min at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2024Quote: ... 1µl each of 100 µM primers Sol-PrimerA (5′-GTTTCCCACTGGAGGATA-N9-3′) and Sol-PrimerB (5′-GTTTCCCACTGGAGGATA-3′) 18 and 0.8 µl Expand High Fidelity enzyme mix (Roche, Basel, Switzerland). Reaction conditions for the PCR were ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...