Labshake search
Citations for Roche :
701 - 750 of 8790 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 10% glycerol and 1 tablet of protease inhibitors (Roche, 11836153001) per 10 ml of solution and lysed by sonication in Bioruptor (UCD-200 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10 µl of cell proliferation reagent WST-1 (Roche, #11644807001) was added to each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl / 10 ml buffer protease and 1x PhosStop (Roche)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% glycerol) supplemented with 1× cOmplete protease inhibitor (Roche, 11836153001) and 1× PhosSTOP phosphatase inhibitor (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... The sections were blocked in Blocking Buffer (5% sheep serum with 10% Roche Blocking Reagent 10x in MABT) for 1 hr at RT and incubated overnight with anti-Digoxigenin-AP (1:4000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 5 μL DNA (10 ng/μL) were amplified using Lightcycler® FastStart DNA Master HybProbe Mix (Roche, Germany) and the respective LightSNiP Assay (TIBMolBiol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei isolated from approximately 2.5x107 cells were resuspended in one ml of extraction buffer (50 mM TrisHCl pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM DTT, 0.25%NP-40, 1x Roche Complete protease inhibitors ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries from 5-10 ng of ChIP DNA was prepared using the KAPA HTP Library Preparation Kit (Roche) by the Next-Generation Sequencing Core at UT Southwestern ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 mM N-ethylmaleimide and Complete protease inhibitor cocktail (Roche, one tablet/10 ml of buffer). HA-tagged ubiquitin was purified using Pierce anti-HA magnetic beads (clone 2–2.2.14) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were lysed with 5mL cold lysis buffer (10 mM Tris-HCl, pH 7.5; 10 mM NaCl; 5 mM MgCl2; 0.1 mM EGTA; 1x complete protease inhibitor; 11836145001 Roche) for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6.8, 10 mM DTT, 1 mM EDTA, 0.1% Tween, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche). The samples were centrifuged at 3000g for 6 min at 4°C using a tabletop centrifuge ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... Cells were resuspended in 450 μl lysis buffer (20 mM Tris pH 7.5, 0.5 mM EDTA pH 8, 200 mM NaCl, 10% glycerol, 1 mM PMSF, 10 mM NEM, Roche cOmplete protease inhibitor catalog # 11836153001) ...
-
bioRxiv - Cell Biology 2024Quote: ... Bound protein was eluted by heating immunoglobulin G beads with 35 μl of denaturing urea SDS-loading dye (1% SDS, 8 M urea, 10 mM Tris, pH 6.8, 10 mM EDTA, 0.01% bromophenol blue, 1x Roche Complete inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μl of forward and reverse primers (each 10 μM) and 10 μl of SYBR Green I (Roche) were combined to a total volume of 20 μl ...
-
bioRxiv - Plant Biology 2024Quote: ... 15 mM MgCl2, 1 mM EDTA, 10 % glycerol, 1 % Triton X-100, 10 mM β-mercaptoethanol, 2 mM PMSF and Roche cOmplete Protease Inhibitor Cocktail)) were added in the ground leaves and incubated for 30 min at 4 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 25μl of 1X PCR buffer B (Kapa Biosystems, Boston, MA, USA) pre-warmed at 65°C was added then the legs were ground ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by mechanical dissociation and treatment with 0.1% collagenase B (Roche) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the transfected cells underwent initial selection with Hygromycin B (Roche, 10843555001) and were subsequently sorted into single colonies in 96-well plates via flow cytometry.
-
bioRxiv - Developmental Biology 2023Quote: ... hiPSCs were selected with hygromycin B (50μg/ml; 843555001, Roche Diagnostics), puromycin (1μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were then dissociated using 0.6 mg/mL collagenase B (Roche) for 1 hour in a 37 °C incubator ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor). The homogenate was centrifuged and the protein concentration of the supernatant was measured using a Pierce 660 nm Protein Assay Reagent (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The proteins were then treated with 8 U PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated with anti-HA antibody (3F10; F. Hoffmann-La Roche AG, Basel, Switzerland) at a 1:300 dilution in PBS containing 3% bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 5% glycerol, and 0.1% Triton X-100 supplemented with Roche Protease Inhibitor cocktail) and then roc ked for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal mouse anti-HA (MMS-101R; Covance) or monoclonal mouse anti-GFP antibodies (11–814–460-001; Roche) prior to secondary antibody treatment with polyclonal goat anti-mouse conjugated to horseradish peroxidase (115–035-146 ...
-
bioRxiv - Microbiology 2021Quote: ... DIG-labeled RNA probes (prepared according to the protocol provided by Roche, Cat. No. 11 277 073 910) or radiolabeled DNA probes and RNA probes were used (Table S5) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... supplemented with phosphatase inhibitor (04-906-837001) and protease inhibitor (11-836-153001s) (both from Roche, Mannheim, Germany) to generate whole-cell extracts (WCEs) ...
-
bioRxiv - Genomics 2022Quote: ... Cycle Pure Kit (Omega) and then labelled with either biotin–16-dUTP or digoxigenin–11-dUTP (Roche Diagnostics) using the BioPrime Array CGH random priming kit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... purpureum gDNA probe was labeled with digoxigenin-11-dUTP (DIG) using a DIG Nick Translation Kit (Roche Diagnostics). Hybridization was performed as described in the Instruction Manual of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics) ...
-
bioRxiv - Evolutionary Biology 2021Quote: The PCR products of the NgGspE and NgGspF genes were labelled by alkali-stable digoxigenin-11-dUTP (Roche) using DecaLabel DNA Labeling Kit (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fosmid and BAC clones (BACPAC Genomics) were labelled by nick translation with digoxigen-in-11-dUTP (Roche, #11093070910) or biotin-16-dUTP (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... then incubated in 2 ml HBSS solution containing 2.5 mg/ml collagenase A (Roche, 11 088 793 001) and 10 mg/mL pancreatin (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNase and one cOmplete™ EDTA-free protease inhibitor cocktail tablet (Roche #11 873 580 001). Cells were lysed using a French press (2x ...
-
bioRxiv - Developmental Biology 2024Quote: ... Digoxigenin-labeled antisense riboprobes for mouse Ccrk were synthesized by in vitro transcription using 11-digoxigenin UTPs (Roche). A Ccrk cDNA fragment for in situ hybridization probe was generated by PCR ...
-
bioRxiv - Immunology 2024Quote: ... SDS buffer (56 mM Tris-HCl pH6.8 buffer with 2.2 % SDS and 11 % glycerol) supplemented with protease inhibitors (cOmpleteTM Mini, Roche). Afterwards ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 10 μl reaction was comprised of 5 μl LightCycler 480 SYBR Green I Master mix (Roche Life Science), 2 μl cDNA template ...
-
bioRxiv - Cell Biology 2020Quote: ... cells from mouse blood infected with the DEH-GFP-expressing parasite were pelleted and then lysed in hypotonic buffer (10 mM Tris-HCl pH 8.4, 5 mM EDTA) containing protease inhibitors (Roche), freeze/thawed twice ...