Labshake search
Citations for Roche :
601 - 650 of 8790 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were finally revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or adding 10 μL of WST-1 reagent (Roche). 2–4 hr after adding the reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... 10% glycerol with 1 tablet protease inhibitor cocktail (Roche). After cell lysis and centrifugation at 30,000g ...
-
bioRxiv - Cell Biology 2022Quote: ... PCLSs were dissociated using Dispase (1:10 dilution; Roche) and 10μg/μl DNase I for 45 mins at 37°C and processed for flow cytometry (see above).
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... protease inhibitor (1 tablet per 10 mL, Roche, 04693159001). The lysate was passed four times through a 26 gauge needle and centrifuged at 1300 x g for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 µg/mL DNAse 1 (Roche, Bäle, Switzerland)) ...
-
bioRxiv - Genetics 2020Quote: ... 10 min DAPI staining (1:5000 in PBS; Roche) and 2 washes with 1xTBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 μL WST-1 (Roche, Sigma-Aldrich, USA) for 1 hour at 37° C in a humidified incubator with 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with DAPI solution (1:10, Roche). After washing ...
-
bioRxiv - Neuroscience 2024Quote: ... protease inhibitor tablets (1 tbl/10 ml, #4693159001, Roche), AEBSF (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... cOmplete protease inhibitor (1 tablet / 10 ml) (Roche, 11697498001). Protein lysates were resolved on a NuPAGE™ 4 to 12% ...
-
bioRxiv - Physiology 2023Quote: ... a protease inhibitor (1 minitab per 10 mL, Roche), pH = 7 ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μl of 10 mM probe (Roche Universal ProbeLibrary), and 36 μl of 2.2X Master mix was dispensed into wells containing 4 μl aliquots of the dilution series or a 4 μl aliquot of distilled water for a negative template control ...
-
bioRxiv - Genomics 2022Quote: ... protease inhibitor (complete mini Roche, 1 tablet/10 ml). Cells were lysed at 4°C by repeated vigorous agitation with 0.5mm zirconia/silica beads in a bead beater (Biospec ...
-
bioRxiv - Bioengineering 2024Quote: 10 µl of the WST-1 assay reagent (Roche) was added to each well (96-well ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche). Insoluble debris was removed by centrifugation at 15000 rpm for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were blocked in 2% TNB (2% blocking reagent (Roche, REF 11 096 176 001) in TNT for 2-3 h at room temperature and incubated with an anti-Fluo-POD antibody (1/50 ...
-
bioRxiv - Neuroscience 2021Quote: ... Post hoc immunostaining was performed using rat anti-HA primary antibodies (Roche, #11 867 423 001) and anti-rat Alexa568 (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were analysed by western blotting using a α-GFP antibody (Roche, 11 814 460 001), and a α-Pgk1 antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... was performed with the In Situ Cell Death Detection Kit/Fluorescein (Roche, 11 684 795 910). Slides were first pretreated with a 2:1 mix of Ethanol:Acetic Acid 5min -20C ...
-
bioRxiv - Cell Biology 2023Quote: ... via in situ pancreas perfusion with 0.8 mg/ml collagenase P (Roche; 11-213-873-001) followed by pancreas digestion and islet purification using Histopaque 1077 and 1119 (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... ATP was detected using the ATP Bioluminescence Assay Kit (HS II-11 699 709 001-Roche) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... HindIII treatment was performed at 37°C for 1 h in 1x reaction buffer B with 10U of HindIII enzyme per reaction (HindIII, 10656321001, Roche, Switzerland). Mung bean nuclease treatment was performed at 30°C for 30 min in 1x mung bean nuclease reaction buffer with 1U per reaction (Mung Bean Nuclease ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10% Glycerol, 1 % Triton-X-100, 1.5 mM MgCl2, 1 mM EGTA, 10 mM Pyrophosphate, 100 mM NaF, Roche protease inhibitor cocktail 1x), and protein level quantified using the Pierce BCA Assay Kit (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.3 M NaCl, 1 mM MgCl2, 10% glycerol, 1 mM EDTA, 1 mM beta-mercaptoethanol, 0.01% IGEPAL CA-630, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Microbiology 2020Quote: ... CMII agar with 250 μg/ml hygromycin B (Roche, Germany), 200 μg/ml G418 (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated with collagenase B (1.8 mg/ml, Roche) and D (2.4 mg/ml ...
-
bioRxiv - Genetics 2023Quote: Bottom Agar + Hygromycin B (Roche Cat#10843555001, 150 μg/mL).
-
bioRxiv - Cell Biology 2023Quote: ... Liver tissue was digested with pronase and collagenase B (Roche) and the cell suspension was subsequently separated by an 11.5% Optiprep gradient (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... Liver tissue was digested with pronase and collagenase B (Roche) and the cell suspension was subsequently separated by an 11.5% Optiprep gradient (Sigma) ...
-
bioRxiv - Bioengineering 2021Quote: ... The chiral nematic liquid crystal mixture RO-TN 407 (F. Hoffmann-La Roche) mixed with 35% w/w CB15 ((S)-4-cyano-4’-(2-methylbutyl)biphenyl ...
-
bioRxiv - Microbiology 2023Quote: ... 12 µl KAPA HiFi HotStart ReadyMix (F. Hoffmann-La Roche AG, Basel, Switzerland), 2.5 µl 2 µM (bacterial and fungal ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM TCEP) containing 1 tablet of complete EDTA-free protease inhibitor cocktail (Roche) and PhosSTOP (PHOSS-RO Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1-3 days in an NBT/BCIP (Roche, Cat No./ID: 11681451001) solution ...
-
bioRxiv - Pathology 2024Quote: ... washed 3 times with 1 ml of PBS containing protein inhibitors (Complete, Roche, Basel) and then manually homogenized in 250 µl of Tris EDTA buffer (20 mM Tris ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM EDTA, 1 mM EGTA, 10% glycerol, 1% Triton X-100, 1 mM DTT, 1 mM PMSF, 1× Roche protease inhibitor cocktail) and about 500 μL of 0.5-mm-diameter glass beads ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...