Labshake search
Citations for Roche :
651 - 700 of 1377 citations for Recombinant Human CD19 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: DNA from the patient and his parents was extracted from 100 μl of EDTA-anticoagulated whole blood using MagNA Pure (Roche Diagnostics, West Sussex, UK) and used for subsequent analyses.
-
bioRxiv - Developmental Biology 2021Quote: ... Antisense DigoxigeninUTP-labeled RNA probes were synthesized at 37°C using RNA DIG labeling mix per manufacturer’s instructions (Roche) using RNA polymerase ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dig-labeled sense and antisense RNA probes for vasa were prepared as described previously [24] (Ambion AM1310, Roche 11277073910). Probes were diluted to 2ng/μL in 100% hybridization solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Developmental Biology 2019Quote: ... The digoxigenin-labeled RNA probes were prepared using a DIG RNA labeling kit according to the manufacturer’s protocol (Roche) using each cDNA clone as the template ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1X Denhardt solution) containing 1μg/ml DIG labeled RNA probes (prepared with a DIG RNA labeling mix, Roche, 11277073910) for overnight at 65°C in a humid chamber ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were purified by precipitation and one microgram each was labeled by nick translation (Invitrogen or Roche Diagnostics) with Cy3-dUTP (GE ...
-
bioRxiv - Cell Biology 2022Quote: ... The labeled cells were directly harvested in 1ml of RIPA buffer including 1X EDTA-free protease inhibitor cocktail (Roche). The lysate was cleared by centrifugation at 20,000g for 15 min ...
-
bioRxiv - Genomics 2022Quote: ... The BAC clone (MSMg01-38O12) was labeled by nick-translation with biotin-16-dUTP (Cat# 11093070910, Roche Applied Science) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sense and antisense riboprobes were transcribed from linearized plasmids and labeled with digoxigenin (DIG RNA-labelling reagents, Roche Biochemicals). Primers used to amplify zebrafish nhsb were 5’ tgatctaccttttctcccatgccatt 3’ and 5’ tctcacacaccacagaggctcca 3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense and sense digoxogenin (DIG)-labeled RNA probes were generated using the DIG RNA labeling kit (Roche Diagnostics, Germany), following the manufacturer’s instructions ...
-
Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafishbioRxiv - Developmental Biology 2022Quote: ... The probes labeled by digoxigenin were detected using alkaline phosphatase coupled anti-digoxigenin Fab fragment antibody (Roche, Basel, Switzerland) with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories ...
-
bioRxiv - Genetics 2023Quote: ... The antisense probe for wdr31 was then transcribed with digoxigenin-labeled UTPs and T7 RNA polymerases (Roche, Basel, Switzerland). The stained embryos were dehydrated in glycerol and photographed with a Nikon SMZ1500 stereomicroscope (Nikon ...
-
bioRxiv - Genomics 2023Quote: ... accession numbers OY726585 and OY726586) were indirectly labeled by PCR in the presence of biotin-16-dUTP (Roche Diagnostics) detected by streptavidin-Cy3 (Sigma–Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... In situ hybridization was performed as previously described19 with custom anti-sense DIG-labeled riboprobes transcribed in vitro (Roche) from amplified cDNA (see Key Resources Table for primers) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We synthesized digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche, Basel, Switzerland) after digestion with the appropriate restriction enzymes BamHⅠ-HF ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymerase T7 or Sp6 (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated with 1 nM DIG (Digoxigenin)-labeled Telomere probes in Hybridization solution (DIG Easy Hyb, Roche) at 42°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used to produce the DIG-labeled single-stranded RNA probes using the DIG RNA labeling kit (Roche, #11175025910). Probes were then cleaned with MegaClear Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was first eluted from the column in 100 µL DNA elution buffer and subsequently the column was treated with recombinant DNase I (20 units/100 µL; Roche Diagnostics) for 30 min at 37°C and finally RNA was eluted in 50 µL nuclease free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001). Anti-FLAG M2 Affinity Gel (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human samples using TriPure Isolation Reagent (Roche). RNA integrity (RIN ...
-
bioRxiv - Genomics 2022Quote: ... the regions of interest were PCR amplified from human genomic DNA (Roche) using Taq polymerase (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: Human TGs were measured using the Cobas c 501 analyzer (Roche Diagnostic). For this purpose ...
-
bioRxiv - Genetics 2023Quote: Candidate regions were PCR-amplified using human genomic DNA (Roche, Basel, Switzerland) as template and cloned in pGL4.23 Firefly luciferase reporter vector (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... eosin and antibodies for human keratins AE1/AE3 (760-2135; Roche diagnostics). Metastasis quantification was reached through a review of 17 digitalized slides ...
-
bioRxiv - Microbiology 2020Quote: ... Disruption of the gene was confirmed by Southern hybridization analysis using the total DNA of mutant candidates digested with SalI and the digoxigenin-labeled probes (Roche), the 1.4-kb ApaI fragment carrying SLG_24970 and the 1.3-kb EcoRV fragment carrying kan.
-
bioRxiv - Cell Biology 2020Quote: The RNA probes were transcribed with the T7 polymerase and labeled using the DIG RNA labeling kit (Roche Cat # 11175025910). After the labeling reaction was complete ...
-
bioRxiv - Developmental Biology 2021Quote: ... Digoxigenin- or fluorescein-labeled riboprobes were synthesized as described (Pearson et al., 2009) and detected with anti-digoxigenin-HRP (1:2000, Roche/Sigma-Aldrich 11207733910 ...
-
bioRxiv - Genetics 2022Quote: ... 10 µl of each PCR product were run in 2% agarose gels alongside digoxigenin (DIG)-labeled size markers VII and VIII (Roche), for 16 hours at 50 V then transferred to a positively charged nylon membrane (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Colorimetric in situ hybridization was performed using DIG-labeled antisense probes with the use of an automated platform (Ventana Discovery, Roche) with RiboMap fixation and BlueMap detection kits (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... and a potential large inversion on chromosome 4 (Supplementary Table 11) were labeled with digoxigenin-11-dUTP (Roche, Indianapolis, IN), biotin-16-dUTP (Roche) ...
-
bioRxiv - Developmental Biology 2019Quote: ... In situ hybridization was performed as previously described (Yaniv et al., 2006) using single-stranded digoxygenin-dUTP-labeled RNA probes transcribed by T7 RNA polymerase (Roche). The PCR generated probes were amplified with the following set of primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... RNA probes were generated using PCR with T7 promoter sequence linkers and subsequently transcribed [DIG or FITC labeled] using T7 polymerase (Roche). Primer sequences are all found in Table 3 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The purified products served as a template for synthesis of digoxigenin-labeled antisense mRNA probes using the DIG RNA labelling mix (Roche). The probes were then purified with RNAeasy mini kit (Qiagen ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting PCR fragments were used as templates for synthesis of digoxigenin (DIG)-labeled antisense and sense riboprobes with the T7/SP6 riboprobe and a DIG-RNA labeling mix (Roche). Sections (8-10 μm ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfected DRG neurons were fixed 15 min in 4 % paraformaldehyde (PFA) and hybridized with DIG-labeled GFP cRNA probes (Roche) as described previously (Merianda et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the membranes were hybridized overnight at 40°C with digoxigenin (DIG)-labeled DNA probes in DIG Easy Hyb solution (Roche). After low and high stringency washes ...
-
bioRxiv - Biochemistry 2020Quote: ... Biotin-labeled CMV-RLuc-EV715’UTR (wild type or CCC mutant)-FLUC and biotin-labeled SL2 (wild type or CCC mutant) were synthesized using biotin-16-UTP (Roche). Binding reaction and pull-down were carried out as described5 ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplified fragments were then used to produce digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche). Whole-mount in situ hybridization was performed following (39) ...
-
bioRxiv - Neuroscience 2020Quote: ... Biotin-labeled probes were synthesized by substitution of DIG RNA labeling mix with biotin RNA labeling mix (Roche, Mannheim, Germany). The probes were precipitated by 4 M LiCl and 100% ethanol ...
-
bioRxiv - Neuroscience 2022Quote: ... high specific-activity RNA probes were produced from a linearized plasmid (HindIII) and labeled using the Fluorescein RNA Labeling Mix (Roche), following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... pre-let-7 and pre-miR-16 molecules (miRVana) were radioactively 5’-labeled with 32P isotopes by incubation with 32P-ƴATP and the phosphorylating enzyme T4 PNK (Roche) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals) as recommended by the supplier ...
-
bioRxiv - Bioengineering 2021Quote: Biotin-labeled dsDNA template was first amplified from the plasmid encoding the template design with biotin-labeled primers using KAPA HiFi HotStart ReadyMix PCR Kit (Roche) for 35 cycles (98°C for 20 s ...
-
bioRxiv - Biophysics 2021Quote: ... or a multiply digoxigenin-labeled tail (MT) to the coverslip coated with anti-digoxigenin (Roche Life Science, Indianapolis, IN, USA). The opposite end of the DNA was attached to a streptavidin-coated bead via a single biotin (TPM) ...
-
bioRxiv - Developmental Biology 2022Quote: Digoxigenin-labeled RNA probes (sense and antisense) were generated by transcription in vitro using SP6 or T7 RNA polymerases (Roche) as previously described (Cruz et al. ...
-
bioRxiv - Zoology 2022Quote: ... The DIG-labeled hsd3b probe was visualized by using a horseradish peroxidase-conjugated anti-DIG antibody (Roche Diagnostics, Basel, Switzerland) and TSA Plus Cy3 System (PerkinElmer ...