Labshake search
Citations for Roche :
651 - 700 of 1261 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Plant Biology 2020Quote: ... Western blotting was performed with mouse anti-GFP (1/1,000, Roche, 118144600001) and rabbit anti-ECH73 (1/1,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (1:500; clones 7.1 and 13.1, Roche, cat. # 11814460001), rabbit anti-TgATG8 (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study included mouse monoclonal anti-GFP (Roche Diagnostics), rat anti-HA (Roche Diagnostics) ...
-
bioRxiv - Molecular Biology 2021Quote: ... All other antibodies were commercially available: mouse αGFP (Roche, 11814 460 001), rabbit αGFP rabbit (life technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse islets were isolated by digesting the pancreas with collagenase P (Roche) and performing density gradient centrifugation as previously described [70] ...
-
bioRxiv - Microbiology 2021Quote: ... and Discovery OmniMap anti-mouse HRP (Roche Tissue Diagnostics cat# 760-4310). Slides were mounted using ProLong Diamond Antifade mountant w/ DAPI (Invitrogen cat# P36971).
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (1:500; clones 7.1 and 13.1, Roche, cat. # 11814460001), mouse MAb 45.56 anti-TgIMC1 (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: Antisera used: 1:200 mouse anti-GFP clones 7.1 and 13.1 (Roche), 1:500 rat anti-HA clone 3F10 (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse monoclonal anti-GFP antibody is a commercial product from Roche (lot #11814460001 ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were immunostained with mouse anti-GFP (1:250 dilution; Roche, 11814460001), rabbit anti-Aldolase-HRP conjugated (1:5000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... and LHCB3 were immunochemically detected with mouse anti-GFP (1:10,000; Roche), rabbit anti-LHCB1 (1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti-GFP (mouse; 11814460001; clones 7.1 and 13.1 mix; Roche, Basel, Switzerland) antibody was used to detect the TC10 biosensor or fluorescently tagged TC10 protein.
-
bioRxiv - Microbiology 2019Quote: PLA and ISH-PLA were carried out using mouse anti-digoxin (Roche) and rabbit anti-Flag (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1° antibodies used: α-GFP 1:1000 dilution (Mouse, Roche, Cat.No. 11814460001), α-Tubulin (TAT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Splenocytes were fused with PAI mouse myeloma cells using polyethylene glycol (Roche). Hybridoma supernatants were screened by indirect ELISA with His-tagged Sec23A as the antigens ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Physiology 2021Quote: ... midguts were incubated with 1:500 anti-GFP (mouse) antibody (Roche #11814460001) for 3h ...
-
bioRxiv - Cell Biology 2022Quote: ... was coupled to 1 μg monoclonal mouse anti-GFP antibody (#11814460001, Roche) and incubated with protein extracts ...
-
bioRxiv - Cell Biology 2022Quote: ... Other primary antibodies used for immunoblotting include mouse anti-GFP (Roche, 1814460) and rabbit anti-myc (Cell Signaling ...
-
bioRxiv - Cell Biology 2022Quote: ... Beads were incubated with 3.5 μg mouse anti-GFP antibody (11814460001, Roche) for a minimum of 10 min on room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... as loading control and incubated with a mouse α-GFP antibody (Roche). An HRP-coupled goat α-mouse antibody (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Antibodies for western blotting were diluted as follows: mouse anti-GFP (Roche) 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation in mouse anti-BrdU (1:400, Roche, Basal, Switzerland), goat anti-DCX (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: Mouse DRG tissues were dissociated with 1 mg/ml Collagenase/Dispase (Roche) in a shaking incubator for 90 min ...
-
bioRxiv - Microbiology 2023Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...