Labshake search
Citations for Roche :
551 - 600 of 1261 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2022Quote: ... using primary antibodies against GFP (Mouse mAb clone, #11814460001, Roche) and TPX2 (rabbit polyclonal antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP using 1:100 mouse Clones 7.1 and 13.1 (Roche) or 1:200 rabbit anti-GFP polyclonal antibodies generously provided by M ...
-
bioRxiv - Cell Biology 2019Quote: ... Mouse Monoclonal antibodies used for immunoblotting were: GFP (Roche, 11814460001), ubiquitin (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-EGFP clones 7.1 and 13.1 (mouse monoclonal, Roche 11814460001), anti-Endophilin A2 clone H-60 (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP clones 7.1 and 13.1 (Sigma Roche: 118144600010) 1:1000 and mouse anti-clathrin heavy chain TD.1 (hybridoma ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-Myc (Roche, cat #C755B26, 1:500 for ICC), mouse anti-LAMP1 (DSHB ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Roche, cat #11814460001, 1:10,000 for WB), rabbit anti-EEA1 (Cell Signaling Technology ...
-
bioRxiv - Physiology 2022Quote: Mouse pancreata were digested with collagenase P (Roche; Basel, Switzerland) and islets were isolated using density gradient centrifugation (82) ...
-
bioRxiv - Plant Biology 2021Quote: ... and a mouse anti-GFP monoclonal antibody (1:5,000; Roche).
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-bromodeoxyuridine (BrdU, Roche; Cat# B8434, dilution 1:300), mouse anti zona occludens 1 (ZO1 ...
-
bioRxiv - Plant Biology 2019Quote: ... and a mouse anti-GFP monoclonal antibody (1:5,000; Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... Antibodies used were mouse anti-HA (Roche; 12CA5, 1:200), rat antitubulin (1:200) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated with anti-GFP (1:500, mouse mAb, Roche) with 2% normal goat serum in PBT at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... was applied and visualized with anti-mouse OmniMap-HRP (Roche) and detected with Discovery Purple (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary antibodies were c-Myc (monoclonal, from mouse, by Roche) and c-Myc (polyclonal ...
-
bioRxiv - Cell Biology 2022Quote: ... pombe extracts with mouse monoclonal anti-HA antibody (12CA5, Roche). Immunoreactive bands were revealed with anti-mouse or anti-rabbit HRP-conjugated secondary antibodies (Abcam) ...
-
bioRxiv - Cell Biology 2022Quote: Mouse islets were isolated using collagenase P (Roche Applied Science) injected into the pancreatic duct ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-GFP (Roche, clones 7.1 and 13.1, 2µg/ml) and mouse anti-αTubulin primary antibodies (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:500, monoclonal 7.1 and 13.1, Roche), mouse anti-Flag (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used were mouse anti-GFP (1:300, Roche 11814460001 Anti-GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-hemagglutinin (HA) antibody (11583816001, 1:3000) from Roche Applied Science (Penzberg ...
-
bioRxiv - Cell Biology 2023Quote: Mouse mAb against GFP (Sigma, Cat#11814460001 Roche; RRID: AB_390913)
-
bioRxiv - Cell Biology 2024Quote: ... 12 μg of mouse monoclonal anti-GFP antibodies (11814460001; Roche) preconjugated with 60 μl slurry of Protein-G magnetic beads (10004D ...
-
bioRxiv - Biophysics 2023Quote: 10 µg/mL mouse anti-GFP (Roche. Cat no. 11814460001) in PBS was incubated on a tunnel slide for 5 min at room temperature ...
-
bioRxiv - Plant Biology 2024Quote: ... blots were probed with mouse anti-GFP antibody (Roche, #11814460001) used at 1/5000 dilution followed by rabbit Anti-Mouse HRP secondary antibody (AbCam ab6728 ...
-
bioRxiv - Cell Biology 2023Quote: ... 12 μg of mouse monoclonal anti-GFP antibodies (11814460001; Roche) preconjugated with 60 μl slurry of Protein-G magnetic beads (10004D ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and Nitro Blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate NBT/BCIP (Roche Diagnostics). In situ hybridizations were based on the Carroll lab “Drosophila abdominal in situ” protocol (http://carroll.molbio.wisc.edu/methods.html ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.