Labshake search
Citations for Roche :
6401 - 6450 of 6963 citations for Rat Antigen peptide transporter 2 TAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The pooled library was quality-checked by Fragment Analyzer (Advanced Analytical) and quantified with the KAPA Library Quantification Kit for ABI Prism (Kapa Biosystems). Sequencing was conducted in a 1×100 run on a HiSeq 4000 at the University of Oregon Genomics and Cell Characterization Core Facility (Eugene ...
-
bioRxiv - Immunology 2019Quote: ... The quantity and quality of each pool was assessed using a Fragment Analyser and by qPCR using an Illumina Library Quantification Kit (KAPA Biosystems) on a Light Cycler LC480II (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... All q-PCRs were performed in Rotor-Gene 6000 (Corbett Life Science) and using FastStart Essential DNA Green Master Kit (Roche, Switzerland). The total volume for qPCR was 10 μl ...
-
bioRxiv - Genomics 2021Quote: ... RNA sequencing libraries were prepared on a Beckman Coulter Biomek i7 liquid handling platform using Roche Kapa mRNA HyperPrep strand specific sample preparation kits (Roche 08098123702) from 200 ng of purified total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... a paired-end library with a target insert size of 550-bp was prepared using KAPA LTP Library Preparation Kit (KK8232; Roche, Switzerland) without amplification ...
-
bioRxiv - Genetics 2020Quote: ... Amplicons were pooled to 10 nM in EB buffer and the final concentration was determined using the Illumina Universal qPCR Amplification kit from Kapa Biosystems. All pooled samples were diluted to 4 nM ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were assessed using Bioanalyzer DNA High Sensitivity chips and quantified by quantitative PCR using Kapa Library Quantification Illumina/ABI Prism Kit protocol (KAPA Biosystems). Validated libraries were pooled in equimolar quantities and paired-end sequenced on an Illumina HiSeq X platform following Illumina’s recommended protocol to generate paired-end reads of 150 bases in length.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fragments were end-repaired, A-tailed and ligated to Illumina compatible adapters (IDT, Inc) using a KAPA-Illumina library creation kit (KAPA biosystems). For CLR libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... Library size distribution was checked on an Agilent high-sensitivity DNA chip and the concentration of the indexed library was determined using the KAPA library quantification kit (KAPA Biosystems) according to the manufacturer’s instructions on the StepOnePlus system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit (Kapa Biosystems, Woburn, Massachusetts) prior to cluster generation ...
-
bioRxiv - Genomics 2021Quote: ... RNA sequencing libraries were prepared on a Beckman Coulter Biomek i7 liquid handling platform using Roche Kapa mRNA HyperPrep strand specific sample preparation kits (Roche 08098123702) from 200 ng of purified total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... cDNA libraries were prepared from poly(A)-captured mRNA using a KAPA RNA HyperPrep Kit (Roche, Basel, Switzerland, Cat No. KK8541) with Truseq adapters ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 ng of cDNA were used for qPCR with the KAPA SYBR FAST qPCR Kit (KK4604, KAPA Biosystems, Wilmington, MA, USA) and the experiment run on the Biorad CFX96 system using the TqPCR protocol described in Zhang et al ...
-
bioRxiv - Microbiology 2021Quote: ... The fragments were treated with end repair, A-tailing, and ligation of Illumina-compatible adapters (IDT, Inc) using the KAPA Illumina Library prep kit (KAPA biosystems). Libraries for the rest of the samples were prepared in 96-well plates ...
-
bioRxiv - Biochemistry 2021Quote: ... the amino acid Thr at position 206 was mutated to Trp using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, USA) together with the designed complementary primers (5’- CCTATCTGATTCATGAGCACATGGTTATTTGGGATCGCATTGAAAAC-3’ and 5’- GTTTTCAATGCGATCCCAAATAACCATGTGCTCATGAATCAGATAGG-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then hybridized overnight at 70 °C with a digoxigenin (DIG)-labeled RNA probes (DIG RNA labeling kit, Roche 11277073910) for Gadd45b mRNA ...
-
bioRxiv - Neuroscience 2020Quote: ... Titration of the viral vectors was performed by qPCR using a KAPA SYBR® FAST qPCR Master Mix Kit (Kapa Biosystems). The titre was 7.9 × 1013 GC/ml for AAV9/GFP ...
-
bioRxiv - Developmental Biology 2021Quote: ... The libraries were quantified by fluorometry on a Qubit instrument (LifeTechnologies) and by qPCR with a Kapa Library Quant kit (Kapa Biosystems) prior to sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA sequencing libraries were generated from up to 250ng of total RNA and were prepared using a KAPA RNA HyperPrep kit (Roche Diagnostics) with polyA selection and indexed using a KAPA Dual-Indexed adapter kit (Roche Diagnostics) ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were then quantified through real-time PCR with the KAPA Library Quant Kit for Illumina (KAPA Biosystems catalog no. KK4835). Finally ...
-
bioRxiv - Genomics 2020Quote: ... The six STARR-Seq RNA replicate libraries and a STARR-Seq Plasmid DNA input library (amplified as before but with 20 ng DNA input and 15 PCR cycles) were normalized with the KAPA Library Kit (KAPA Biosystems) and sequenced on an Illumina NextSeq with 150-bp paired-end reads using standard protocols.
-
bioRxiv - Molecular Biology 2021Quote: Random primed DNA probes were generated by using the Random Primed DNA Labeling Kit from Roche (cat# 11-004-760-001). Generally ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized with 12 μL of RNA and anchored oligo(dT)18 primer in a 20 μL reaction using the Transcriptor First Strand cDNA synthesis kit at 55°C for 30 min for reverse transcriptase reaction (Roche Diagnostics).
-
bioRxiv - Microbiology 2020Quote: ... One μg of intact total RNA per condition was used to make stranded mRNA-seq libraries with the Stranded mRNA-Seq kit (KAPA Biosystems) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Microbiology 2020Quote: ... free of contaminating DNA) were directed for library preparation using Kapa Stranded mRNA Library Preparation Kit (Roche Diagnostics Corporation, Indiana, USA) and sequencing in an Illumina HiSeq 4000 platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcription was performed on the pcr product with Ampliscribe T7-flash kit with Dig RNA labeling mix from Roche(75). In situ hybridization with both the anti-sense probes yielded the same results.
-
bioRxiv - Microbiology 2021Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit (Kapa Biosystems, Woburn, Massachusetts) prior to cluster generation ...
-
bioRxiv - Molecular Biology 2020Quote: ... A particular tRNA was hybridized with a corresponding antisense oligo DNA probe shown in Table S1 labeled with digoxigenin (DIG) using DIG Oligonucleotide Tailing Kit (Roche Diagnostics) in Hybridization Solution [0.50 M Na2HPO4 ...
-
bioRxiv - Genetics 2019Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... NGS sequencing adapter addition and multiplex indexing of DNA samples was achieved using the KAPA Hyper Prep Kit (KAPA Biosystems KK8502) according to manufacturer instructions ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR was performed in a final volume of 20 µl containing 20 ng of cDNA using SYBR Fast Universal qPCR Kit (Kapa Biosystems) and analyzed using the Quant Studio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: ... 250 ng of genomic DNA was sheared and libraries were prepared using the KAPA HyperPrep Kit (Kapa Biosystems, Wilmington, MA, USA). For each RNA sample ...
-
bioRxiv - Genomics 2020Quote: ... Synthesis of cDNA was performed with 150 ng of total RNA using the First Strand cDNA Synthesis kit (Roche Applied Science) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were quantified by qPCR using the Library Quantification Kit for Illumina sequencing platforms (cat#: KK4824, KAPA Biosystems, Boston, MA, USA), using 7900HT Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... a total of 1.0 μg of extracted DNA was used as the starting material for PCR-free library construction (KAPA HyperPrep PCR-Free Library Prep kit; Roche, #KK8505); libraries were then mechanically sheared (Covaris microtube system ...
-
bioRxiv - Genomics 2020Quote: ... the concentration of ligated fragments in each library was quantified (KAPA Library Quantification Kits for Illumina platforms; Roche/KAPA Biosystems, # KK4824). Libraries with concentrations of more than 3 nM and fragments with peak size 400 bp were sequenced on an Illumina Novaseq 6000 S4 and/or S2 Flow Cell (FC) ...
-
bioRxiv - Genomics 2020Quote: ... the concentration of ligated fragments in each library was quantified (KAPA Library Quantification Kits for Illumina platforms; Roche/KAPA Biosystems, # KK4824). Libraries with concentrations of more than 3 nM and fragments with peak size 400 bp were sequenced on an Illumina Novaseq 6000 S4 and/or S2 Flow Cell (FC) ...
-
bioRxiv - Genomics 2021Quote: ... 30μL from each was plated and diluted to 10ng/μL using 10mM Tris-HCl and sequencing libraries were prepared in triplicate using a miniaturized version of the KAPA HyperPlus kit (Roche, KK8514) with Illumina-compatible KAPA Unique Dual-Indexed Adapters (Roche ...
-
bioRxiv - Immunology 2022Quote: ... A total amount of 200ng RNA per sample was used for the preparation of RNA sequencing libraries using the KAPA RNA HyperPrep Kit with RiboErase (HMR) (KAPA Biosystems). In short ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems) prior to cluster generation.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio) and a LightCycle®96 (Roche) real-time PCR detection system ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified by fluorometry on a Qubit instrument (LifeTechnologies, Carlsbad, CA) and by qPCR with a Kapa Library Quant kit (Kapa Biosystems-Roche) prior to sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We prepared the WGBS libraries according to MethylC protocol (Urich et al., 2015) and quantified them using a combination of KAPA Library Quantification kits (Kapa Biosystems) and an Agilent High Sensitivity DNA kit (Agilent Genomic) ...
-
bioRxiv - Physiology 2022Quote: ... 250 ng of total RNA was used to prepare barcoded RNA-seq libraries using Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems). Samples were sequenced on the HiSeq 2500 (Figure 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality control was performed with an Agilent 2100 Bioanalyzer and quantity determined via the KAPA Library Quantification Kit (KAPA Biosystems).