Labshake search
Citations for Roche :
6051 - 6100 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 30% glycerol [w/vol] and bromophenol blue) and 1 µl of proteinase K (14–22 mg/ml, Roche) and incubating at 37 °C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lysed in NP-40 buffer (150 mM NaCL, 1% IGEPAL, 50 mM Tris-Cl p.H. 7.5) with protease inhibitor (Roche #04693132001 ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed with 1 μg of purified RNA using Transcriptor First Strand cDNA synthesis KIT (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the striatal/accumbal slices were sonicated in 300 µL lysis buffer (50 mM Tris-HCl [pH 7.5], 1 mM EGTA, 20 mM MgCl2, 500 mM NaCl, 0.5% NP-40, protease inhibitor cocktail [Roche] ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclear pellets were resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 7.5, 1X Roche protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Bacterial pellets were collected via centrifugation at 4°C and 5,000g and resuspended in ice-cold lysis buffer (50 mM MES pH 6.8, 1 mM EGTA, 0.2 mM MgCl2, 5 mM DTT, Roche complete protease inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were dewaxed and antigen retrieval was performed using Discovery Cell Conditioning 1 (Roche Tissue Diagnostic, ref. 06414575001) for 32 minutes at 95°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were dewaxed and antigen retrieval was performed using Discovery Cell Conditioning 1 (Roche Tissue Diagnostic, ref. 06414575001) for 32 minutes at 95°C.
-
bioRxiv - Biochemistry 2024Quote: ... Frozen cell pellets were resuspended in Lysis Buffer (50 mM HEPES [pH 7.5], 100 mM NaCl, 1 mM NaF, 0.1% βME with Roche EDTA-free protease inhibitor tablets ...
-
bioRxiv - Microbiology 2024Quote: HIV-1 RNA levels were measured in cell-free CSF and plasma at each site using the ultrasensitive Amplicor HIV-1 Monitor assay (versions 1.0 and 1.5; Roche Molecular Diagnostic Systems ...
-
bioRxiv - Cell Biology 2024Quote: The parasite culture was pelleted and suspended in PBS containing 1 × complete protease inhibitor cocktail (Roche, Basel, Switzerland). Saponin (at a final concentration of 0.15% ...
-
bioRxiv - Microbiology 2024Quote: ... 500mL of Buffer 1 (20mM KHEPES pH 7.9, 50mM KCl, 10% Glycerol) with a protease inhibitor tablet (Roche) was added and samples were subject to ultrasonication in a cup horn sonifier (Branson ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM MgCl2, 0.1% NP-40, 5 mM DTT, 0.5 mM PMSF, 1× EDTA-free protease inhibitor cocktail [Roche] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.5 % SDS, 1#x00D7; protease inhibitor cocktail from Roche). The resulting nuclei were spun down ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... 1% Triton X-100, 0.1% sodium deoxycholate, 1mM EDTA, 5mM MgCl2, 1mM DTT, 0.5mM PMSF, 10mM NaF, Roche PhoSTOP ...
-
bioRxiv - Plant Biology 2024Quote: ... 1mM DTT and 20 mM imidazole supplemented with 1 tablet of cOmplete™ EDTA-free protease inhibitor (Roche) per every 50 ml ...
-
bioRxiv - Plant Biology 2024Quote: ... Tissues were ground with mortor and pestle and resuspended in 30 mL extraction buffer 1 (10 mM Tris-HCl, pH 8.0, 5 mM βmercaptoethanol, 0.4 M sucrose, protease inhibitor cocktail (cOmplete, Roche), vortexed ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... washed with cold PBS and then lysed for 4 hours on rotation at 4°C in TNEN buffer (50 mM Tris pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.1% NP-40, Protease inhibitors (Roche) and phosphatase inhibitors (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... followed by a subsequent incubation at 95 °C in pre-formulated Cell Conditioning 1 solution (Roche Diagnostics, Canada). Following this ...
-
bioRxiv - Plant Biology 2024Quote: ... supplemented with 1 tablet of protease inhibitor cocktail per 10 ml buffer (cOmplete™ Proteasehemmer-Cocktail, ©Roche) with an ultrasonic homogenizer (Hielscher Ultrasonics UP200St ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were stopped by adding 0.5 μl ethylenediaminetetraacetic (0.5 M EDTA) and 1 μl Proteinase K (19 mg/ml, Roche), and incubated at 50°C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 72°C for 1 min) All PCR was performed using KAPA HiFi HotStart ReadyMix (Kapa Biosystems; KK2602). The PCR products were isolated by QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Pathology 2024Quote: ... Pre-cleared lysates (containing 1 mg of protein) were then incubated with mouse monoclonal anti-GFP antibodies (Roche) coupled to G-protein beads for 3 h at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the samples were washed two times with 300 μL of 1%BSA antibody buffer (20mM HEPES– KOH, pH 7.5, 150 mM KCl,0.5 mM Spermidine, 1X Roche cOmplete Mini EDTA-free Protease Inhibitor ...
-
bioRxiv - Microbiology 2024Quote: ... and its activity was measured by addition of 1 mM chlorophenol red-β-D-galactopyranoside (Roche Diagnostics, GmbH) in 100 mM HEPES pH 8 (Dutscher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pull-down was performed on the cell lysates by adding 1 µg of α-HA (Sigma Roche 12CA5) or mouse α-IgG (Santa Cruz Biotechnology sc-2025 ...
-
bioRxiv - Cell Biology 2024Quote: ... Bound protein was eluted by heating immunoglobulin G beads with 35 μl of denaturing urea SDS-loading dye (1% SDS, 8 M urea, 10 mM Tris, pH 6.8, 10 mM EDTA, 0.01% bromophenol blue, 1x Roche Complete inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2024Quote: ... NaCl 140 mM, EDTA 1 mM, Glycérol 10 %, NP40 0.5 %, AEBSF 1mM, Protease inhibitor cocktail Complete 1x, Roche) and resuspended in 30 µl of Laemmli buffer (1 x) ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 mL of lysis buffer (25 mM Ammonia Bicarbonate (AmBic) with protease inhibitors (Roche complete protease inhibitor tablets)) was used to resuspend the thawed pellets and the sample was transferred to a 2 mL screw cap vial for bead beading in 2 mL Precellys vials prefilled with 0.5mm glass beads ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR was performed on LightCycler© 480 thermocycler using the SYBR Green 1 Master kit (Roche, Switzerland). Primers were used at 200 nM ...
-
bioRxiv - Microbiology 2024Quote: ... 150 mM NaCl) supplemented with complete EDTA-free protease inhibitor cocktail (1 tablet/50 ml of lysate; Roche) and 1 mg/ml lysozyme (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Developmental Biology 2024Quote: ... harvested and lysed 14 h later in 300 µl binding buffer (20 mM HEPES pH 7.6, 150 mM MgCl2, 10% glycerol, 0.05% NP-40, 1 mM DTT, ROCHE cOmpleteTM ULTRA-tablet Mini protease inhibitor) ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in 150 µl of lysis buffer (PBS 1X, 1% protease inhibitor cocktail EDTA-free, Roche) and lysed by sonication (amplitude 70% ...
-
bioRxiv - Plant Biology 2024Quote: ... The membranes were then probed with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche), HRP-conjugated FLAG M2 (1:5000 ...
-
bioRxiv - Pathology 2024Quote: ... Slides were incubated for 30 minutes with 1 unit of DNase I (Roche, Cas. No. 9003-98-9) at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Nuclei were centrifuged at 4°C at 1,300 x g for 4 min and then resuspended in 1 mL of Wash Buffer (20 mM HEPES pH7.5, 150 mM NaCl, 0.5 mM spermidine, supplemented with Roche complete EDTA-free protease inhibitor tablet) ...
-
bioRxiv - Pathology 2024Quote: ... by directly assessing 1 drop of whole blood using an Accu Chek Aviva glucose meter (Roche Diagnostics, Germany).
-
bioRxiv - Neuroscience 2024Quote: ... Crosslinked tissue was resuspended in 1.5 mL lysis buffer (1X PBS, 1% NP-40, 0.5% NaDOC and 0.1% SDS with cOmplete protease inhibitors (Roche)) ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5% (v/v) Triton X-100) to leave only matrix before treatment with 10μg/ml DNAse 1 (Roche) to cleave phosphodiester linkages in the DNA backbone ...