Labshake search
Citations for Roche :
6001 - 6050 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were homogenized in RIPA buffer (dH2O; 1% Igepal; 150 nM NaCl; 0.1% SDS; 0.5% SOD; 50 mM Tris) containing protease inhibitor (Roche) and phosphatase inhibitor (ThermoScientific ...
-
bioRxiv - Genomics 2024Quote: ... Cell pellets were resuspended in 250 µL ice-cold Hi-C lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630, 1 tablet/10 mL Roche complete mini EDTA-free protease inhibitor) ...
-
bioRxiv - Immunology 2024Quote: ... the cell pellet was re-suspended and incubated in 1 ml of Red Blood Cell Lysis Buffer (Roche) for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... RNA was harvested by removal of culture medium and addition of 200 µl of 1 M DTT (Roche) supplement Kingfisher RNA lysis buffer (Thermofisher) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Microbiology 2024Quote: ... and subsequently resuspended in 1 mL of lysis buffer (0.5% NP40, 50 mM Tris–HCl pH 7.4; 150 mM NaCl, 1 mM EDTA, cOmplete protease (Roche) and PhosSTOP phosphatase (Roche ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Microbiology 2024Quote: ... The purified parasites were lysed in 200 μl RIPA buffer (150mM NaCl, 10 mM TrisHCl, pH 7.5, 0.1% SDS, 1% TX100 containing 2x protease inhibitor cocktail (Roche), and 1 mM PMSF ...
-
bioRxiv - Biophysics 2024Quote: ... A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems; 1-μL qPCR template, 15 cycles maximum). We amplified corresponding regions of pSC101_TetR_specR with primers that linearized the backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was dried overnight and then lysed with glass beads in lysis buffer (Tris-HCl [pH 7.5], 1 mM EDTA, 2.75 mM DTT, protease inhibitor cocktail (cOmplete EDTA-free [Roche]). Next 3x SDS sample buffer (187.5 mM Tris [pH 6.8] ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclear pellets were resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 7.5, 1X Roche protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Bacterial pellets were collected via centrifugation at 4°C and 5,000g and resuspended in ice-cold lysis buffer (50 mM MES pH 6.8, 1 mM EGTA, 0.2 mM MgCl2, 5 mM DTT, Roche complete protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed with 1 μg of purified RNA using Transcriptor First Strand cDNA synthesis KIT (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the striatal/accumbal slices were sonicated in 300 µL lysis buffer (50 mM Tris-HCl [pH 7.5], 1 mM EGTA, 20 mM MgCl2, 500 mM NaCl, 0.5% NP-40, protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cancer Biology 2023Quote: Orthotopically implanted syngeneic KPC3 tumor tissues were harvested and digested with 1 mg/mL Collagenase D (Roche, Switzerland) plus with 100 μg/mL DNase I (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated in a HBSS solution (1 ml per well) containing 10 U/ml of dispase II (Roche) and 125 U/ml of collagenase type IV (Sigma ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA samples were separated on 1% agarose formaldehyde gels and transferred to Hybond-N membranes (Roche Molecular Biochemicals). Membrane hybridization was carried out overnight at 65°C using digoxigenin-labeled riboprobes corresponding to PVX CP sequences.
-
bioRxiv - Molecular Biology 2023Quote: ... and lysed in NP-40 buffer (150 mM NaCL, 1% IGEPAL, 50 mM Tris-Cl p.H. 7.5) with protease inhibitor (Roche #04693132001 ...
-
bioRxiv - Microbiology 2022Quote: ... Uninfected erythrocytes were removed using saponin buffer (0,1% saponin/PBS plus 1× cOmplete™ protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG was detected with anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche, Indianapolis IN; 1:2000 dilution). Alkaline phosphatase activity was revealed using NBT/BCIP (Roche ...
-
bioRxiv - Immunology 2022Quote: ... The pellets were further digested in the presence of 1 mg/ml of collagenase/dispase (Roche Applied Science) and 1 mg/mL DNase in DMEM for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA (1 μg per replicate) was used for library preparations using the KAPA RiboErase Kit (HMR) (Roche) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Beads were incubated with immature and mature DC lysates prepared in RIPA buffer (10 mM HEPES, 50 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, protease inhibitor cocktail (Roche), 1 mM Na3VO4,1 mM DTT ...
-
bioRxiv - Developmental Biology 2022Quote: ... The bound ribopropbe was detected using an alkaline phosphatase-conjugated goat anti-DIG Fab fragment (1:750; Cat#: 11093274910, RRID:AB_514497; Roche) and the HNPP/FastRed detection kit (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were re-fixed in 4% PFA for 5 min and incubated in 0.2 M HCl for 10 min at RT before treatment with tri-ethanolamine buffer (662.5 µl tri-ethanolamine, 112 µl 1 M HCl, 49.1 µl H2ODT, 125 µl acetic anhydride; Roche). Slides were preincubated at 65°C in hybridization buffer (50% formamide (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT) supplemented with cOmplete Mini EDTA-free protease inhibitor cocktail and PhoshoStop phosphatase inhibitor tabs (Roche) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: Cells or tissue powders were directly dissolved in 1 ml of the TriPure Isolation Reagent (Cat. 11667165001, Roche) and extracted using a column-based kit (Cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Genomics 2022Quote: ... incubated with 1ml MB#1 buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.2% NP-40, 1x Roche cOmplete EDTA-free (Roche diagnostics ...
-
bioRxiv - Genomics 2022Quote: ... Two rounds of washes with Wash Buffer were then performed and nuclei were incubated with ME-A loaded pA-Tn5 diluted 1:200 in 300 Wash Buffer (20 mM HEPES pH7.5, 300 mM NaCl, 0.5 mM spermidine, Roche Complete Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were harvested at indicated time points with RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche: cOmplete mini EDTA-free protease inhibitor ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... Nuclei were then resuspended in 1 mL of Wash Buffer (20 mM HEPES pH7.5, 150 mM NaCl, 0.5 mM spermidine, supplemented with Roche complete EDTA-free protease inhibitor tablet) ...
-
bioRxiv - Molecular Biology 2022Quote: Primary adipocytes were isolated from epi-WAT after digested at 37°C for 1 hr with collagenase (Roche) in KRB supplemented with 3 mM glucose and 1% FA-free BSA ...
-
bioRxiv - Plant Biology 2022Quote: ... resuspended in lysis buffer (20 mM HEPES 150 mM NaCl 20 mM imidazole 1 mM PMSF 0.02% NaN3 pH = 7.4 with Complete protease inhibitor cocktail, Roche) and sonicated on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... incubated with proteinase K (1 mg/mL in 100 mM Tris-HCl, pH 8.0, 50 mM EDTA; Roche) at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Neuroscience 2023Quote: The other brain halves (frozen) were homogenized in 1 mL PBS containing complete protease inhibitor (Roche Applied Science) and 1 mM AEBSF (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... Slides were washed 10 min in washing buffer and incubated 1 h in blocking buffer (both Roche #11585762001). Anti-DIG antibody was added (Roche #11093274910 - 1:1500 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... cOmplete™ Mini Protease Inhibitor Cocktail EASYpacks tablet (1 tablet for 10mL of lysis buffer) (Roche, Cat # 04693124001)) and manually homogenized ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were lysed in 1 ml of mild lysis buffer containing protease inhibitor mixture (Roche Life Sciences) and phosphatase inhibitor mixture (EMD Millipore) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysis was performed with Buffer NP40 (50mM Hepes pH 7.5, 150mM KCl, 2mM EDTA, 0.5% NP40, 1mM DTT, and 1 Roche protease inhibitor tablet for 10 mL of buffer).
-
bioRxiv - Cell Biology 2023Quote: Cells were re-suspended in 0.1% NP-40-PBS (1ml/1×107 cells) with 1X Protease Inhibitors (Roche) and 1mM DTT ...