Labshake search
Citations for Roche :
5501 - 5550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... was mixed 1:50 in Dig-300 buffer (without digitonin, 20 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 0.5mM spermidine, Roche Complete Protease Inhibitor EDTA-free) and beads were resuspended 100 uL and nutated at room temperature for 1 hour ...
-
bioRxiv - Genetics 2023Quote: ... Cells were incubated overnight in primary antibodies targeting GFP to stain GFP labelled CTCF or RAD21 (Roche, 11814460001) or SON (abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... 10%glycerol) with cocktail of protease inhibitors (#11836145001, Roche) and 0.2% NP40 (#74385 ...
-
bioRxiv - Biophysics 2023Quote: ... and 10 X Protease Inhibitor Cocktail (PIC, Roche) (2 mL per 4 g of cell pellet ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were transcribed in vitro from the vector for 1.5 hours at 37°C with relevant RNA polymerase and the DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Tween-20) and developed with a 1:50 dilution of NBT/BCIP solution (Roche #11681451001) in NTMT at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2,5 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection of 106 cells in a 6-well plate was performed using 5 μl of transfection agent (X-tremeGENE HP Reagent, Roche), 10 μL of bacmid and 85 μL of SF900II-SFM medium (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM β-mercaptoethanol (buffer A) with Complete protease inhibitor cocktail (Roche) and 2 mg DNAse I from bovine pancreas (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and 1× protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2023Quote: Bottom Agar + Hygromycin B (Roche Cat#10843555001, 150 μg/mL).
-
bioRxiv - Genomics 2023Quote: Final libraries were quantified using the KAPA Library Quantification Kit for Illumina (Roche, KK4873) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated with 1 nM DIG (Digoxigenin)-labeled Telomere probes in Hybridization solution (DIG Easy Hyb, Roche) at 42°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA was then transferred onto a Nylon membrane (Nylon Membranes, positively charged, Roche) using a Vacuum Blotting System (VacuGene XL ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated with 1% CDP-star (Roche 11759051001) in AP buffer (50 mM Tris pH 9.5 ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then blocked with Blocking solution (1% Blocking reagent, Roche 11096176001 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by incubation with 0.2% Anti-Digoxigenin-AP Fab fragments (Roche) in Blocking solution for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... and protease inhibitor mix (Roche, 11873580001). Chromatin-associated RNA was extracted using Qiazol lysis reagent (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells were lysed with lysis buffer (0.5% Triton X-100 in PBS) containing protease inhibitors (Roche) for 15 min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting supernatants were incubated for 16 h while rotating at 4°C with 8 µg/ml anti-GFP antibody (Roche). Protein A/G PLUS-Agarose (Santa Cruz ...
-
bioRxiv - Microbiology 2023Quote: ... and quantification of relative mRNA levels using a LightCycler 480 Instrument II (Roche) and Taq-Man PCR technology ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using LightCycler Software 4.1 (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was incubated with 0.5 mL of Ni beads (1 mL slurry, Roche), equilibrated in buffer A500 ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 X complete protease inhibitor (Roche), for 5 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... threshold values for biomarker aggregation also differ (amyloid-β: 192 pg/mL for INNO-BIA AlzBio3, 980 pg/mL for Roche Elecsys ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.5 μl proteinase K (20 mg/ml Roche), and RNase inhibitors were added to each tube and were incubated for 30 minutes at 55°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 192 pg/mL for INNO-BIA AlzBio3, 980 pg/mL for Roche Elecsys; tau: 93 pg/mL for INNO-BIA AlzBio3, 245 pg/mL for Roche Elecsys; phosphorylated tau (p-tau): 23 pg/mL for INNO-BIA AlzBio3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and protease inhibitors (cOmplete EDTA-free protease inhibitor cocktail (Roche), 1 mM PMSF ...
-
Convergence, plasticity, and tissue residence of regulatory T cell response via TCR repertoire prismbioRxiv - Immunology 2023Quote: ... and each lobe was cut into small pieces and digested with Collagenase A (Roche, 1mg/mL), DNAse (30 ug/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... and protease inhibitors (cOmplete mini, Roche) by applying the buffer directly to the plate ...
-
bioRxiv - Immunology 2023Quote: ... lymph nodes were manually minced into pieces and digested with collagenase A (1 mg/mL; Roche) and DNAse (10 µg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was isolated by isopropanol precipitation of cells and tumor lysates (lysis buffer was Tris [pH 8] 100 mM, EDTA 5 mM, SDS 0.2%, NaCl 200 mM, and 1 mg/mL proteinase K [Roche Diagnostics, Mannheim, Germany]) and resuspended in Tris/EDTA (TE ...
-
bioRxiv - Cell Biology 2023Quote: ... The minced muscles were then incubated in 0.1% collagenase D (Roche, Basel, Switzerland) and 0.1% trypsin in Ham’s F12 (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the KAPA HiFi Hotstart ReadyMix (2x) (KAPA Biosystems, KK2602) and the ISPCR-primer AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Genetics 2023Quote: ... Sequencing libraries were prepared using 100 ng fragmented DNA with the KAPA HyperPrep Library Prep Kit (Roche, Indianapolis, IN) and NEXTFLEX UDI barcodes (PerkinElmer ...
-
bioRxiv - Genetics 2023Quote: ... 25 ng of probe DNA was radioactively labelled with α– dCTP 32P using High Prime (Roche, 11 585 592 001), then hybridised to the membrane overnight at 65 °C in Church solution containing 10 μg/ml sonicated Herring Sperm DNA and 10 μg/ml tRNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... The KAPA Library Quantification Kit (Roche) was used for quantification of ATAC-seq and RNA-seq libraries.
-
bioRxiv - Neuroscience 2023Quote: ... 2% NaF) ) supplemented with EDTA-free protease inhibitors (cOmplete™, Roche) for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Brains were then incubated with TUNEL reagent following manufacturer instructions (Roche, in situ cell death detection kit ...
-
bioRxiv - Neuroscience 2023Quote: ... whole-flies or adult heads were homogenized in RIPA lysis buffer with protease inhibitor (Roche) using a mortar and pestle ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR for genotyping was performed using the LightCycler 480 II (Roche, Switzerland) and the SYBR Premix Ex Taq GC (Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... The heads were crushed on ice using a pestle in 0.5% NP-40 lysis buffer (50 mM Tris, 150 mM NaCl, 10% glycerol, 1 mM EDTA, pH 7.5) supplemented with protease inhibitors (Roche). The resulting lysates were clarified by centrifugation and the supernatants were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... Resuspended nuclei were sorted by fluorescence activated cell sorting with DAPI (Roche) labeling ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.2LJmg/mL DNase I (Roche) and 4% Trypsin (0.25% in Tris Saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were blocked with 1% Western Blocking Reagent (WBR; Roche #11921681001) or 5% BSA in TBST buffer for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were lysed in ice-cold RIPA buffer enriched with a complete protease inhibitor cocktail and PhoStop phosphatase inhibitor cocktail (Roche, France). The lysates were then cleared of cell debris by centrifugation at 14,000 rpm for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% NP40 supplemented with protease and phosphatase inhibitor cocktails (Roche, Germany) and pre-cleared with protein A-agarose beads (Roche ...