Labshake search
Citations for Roche :
5251 - 5300 of 5370 citations for QuantiFluo Ammonia Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... was performed with RNAscope® 2.5 VS Reagent Kit (323250, Advanced Cell Diagnostics, Newark, CA) on a Ventana Discovery Ultra platform (Roche Diagnostics, Penzberg, Germany). Sections were exposed to 24 hours antigen retrieval and 16 min protease treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified based on the manufacturer’s instructions before sample barcoding with xGen Stubby Adapter and Unique Dual Index Primers (IDT) and library preparation using KAPA HyperPrep Kit (Kapa Biosystems-Roche, Wilmington, MA). The library was then sequenced by Illumina MiSeq nano PE150 at the Georgia Genomics and Bioinformatics Core ...
-
bioRxiv - Genetics 2023Quote: ... RNA sequencing libraries were prepared as described previously (Ma, Fuqua et al. 2019) using the KAPA Stranded mRNA-Seq Kit (cat #KK8421, KAPA Biosystems, Wilmington, MA). The pooled libraries were sequenced in an Illumina HiSeq4000 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from 500 ng of total RNA using the KAPA mRNA Hyperprep kit (v4.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) before cluster generation.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared by the Van Andel Genomics Core from 1ug of total RNA using the KAPA stranded mRNA kit (v5.16) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... Multiplexed library pool QC was based on Agilent Tapestation 4200 HS D1000 and Kapa Library Quantification Kit for Illumina platforms (Kapa BioSystems, Boston, MA) and sequenced at shallow depths on Illumina’s iSeq 100 v2 flow cell for 26×10×10×90 cycles for estimated reads per cell ...
-
bioRxiv - Immunology 2023Quote: ... and adapter-ligated using the KAPA PCR-free Hyper Prep Kit in combination with KAPA Unique Dual-Indexed Adapters (F. Hoffmann-La Roche AG, Basel, Switzerland). Adapter-ligated libraries were purified by AMPure XP bead cleanup ...
-
bioRxiv - Zoology 2023Quote: ... Digoxigenin-labeled antisense and sense RNA probes were produced from cloned PCR fragments using a digoxigenin RNA labeling kit (SP6/T7; Roche Diagnostics, Basal, Switzerland). Labeling was performed as previously described (Ukena et al. ...
-
bioRxiv - Physiology 2023Quote: ... Library for RNA-Seq was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kit with 201-300bp insert size (KAPA Biosystems, Wilmington, MA) using 250 ng total RNA as input ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: Probes for whole mount ISH and FISH were prepared with RT-PCR using primers listed in Table S7 followed by ligation into pGEM-T Easy vectors and transcribed using a DIG RNA labeling kit (Roche, Cat no. 11175025910), some probes were made using flourescein labeling mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics, #760-229 and # 760-239). These chromogenic dyes are covalently deposited and have unique spectra (83 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA mRNA Hyperprep kit (v4.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Genomics 2023Quote: ... Bank validation was done with the quantification of the complementary DNA with the Standard Sensitivity NGS kit on Fragment Analyzer and with qPCR (ROCHE Light Cycler 480). The sequencing was done on NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The concentration of each library was determined by quantitative PCR (qPCR) via the KAPA Library Quantification Kit for Next Generation Sequencing (KAPA Biosystems; Woburn, MA).
-
bioRxiv - Microbiology 2023Quote: ... and the concentration was measured with the Qubit®/Quant-IT® Fluorometric Quantitation and/or KAPA Library Quantification kit for Illumina platform (KAPA Biosystems). Paired-end sequencing (read length 100 bp ...
-
bioRxiv - Genomics 2023Quote: DNA was purified from 200μL Aptima tube specimens using the MagNA Pure Total Nucleic Acid Isolation Kit I (Roche Applied Science, Indianapolis, IN) external lysis protocol on the automated MagNA Pure 24 Instrument and 50µL elution ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting PCR products were then used as a template for generation of sense and antisense DIG-labelled probes using a DIG-nucleotide labelling kit (Roche, Indianapolis, IN, USA). Hybridised probes within the nematode tissues were detected using an anti-DIG antibody conjugated to alkaline phosphatase and its substrate ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of ligated fragments in each library was quantified with the KAPA Library Quantification Kits for Illumina platforms (Roche/KAPA Biosystems, KK4824) on a Roche LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... We determined the size of the final library construct on the Caliper LabChip GX system and quantified it using qPCR SYBR Green reactions with a set of DNA standards and the Kapa Library Quantification Kit (KAPA Biosystems, Part#KK4854). Size and concentration values were entered into the WikiLIMS database for the sequencing team’s use for appropriate flow-cell loading ...
-
bioRxiv - Microbiology 2023Quote: First-strand cDNA synthesis and quantitative real-time PCR was performed using the KAPA SYBR® FAST kit (CliniSciences) on the LightCycler® 480 (Roche Diagnostics) using the primers indicated in Supplementary Table S6 ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and real-time qPCR reaction were carried out with KAPA SYBR FAST One-Step qRT-PCR Master Mix Kit (KAPA Biosystems, Wilmington, MA) on LighyCycler 480 system (Roche ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A volume of 50 µl (1 µg) of sheared DNA from each sample was used for library preparation using a KAPA Hyper Prep Illumina Kit (KAPA Biosystems, Wilmington, MA) and 48 barcoded adaptors (Bioo Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and ligated to iTru adapters followed by limited-cycle PCR of iTru primers to add indexes and complete the library molecules using Kapa Library Preparation Kit reagents (Kapa Biosystems [Roche, Basel, Switzerland]). We sequenced the pooled libraries on an Illumina sequencer (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche cat# KK4824) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) prior to cluster generation ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then amplified the adapter-ligated libraries with indexing oligos (Glenn lab, University of Georgia) and the KAPA HiFi PCR Kit (Roche, Indianapolis, Indiana, USA) using 16 cycles of PCR ...
-
bioRxiv - Developmental Biology 2024Quote: TUNEL assays were carried out on 10 µm cryosections following the manufacturer’s protocol in the Fluorescein in Situ Cell Death Detection kit (Roche Applied Science, Indianapolis, IN).
-
bioRxiv - Genomics 2024Quote: Library preparation was carried out at the University of Michigan Advanced Genomics Core using the KAPA mRNA Hyper Prep Kit (Roche, Wilmington, MA, USA) with dual indexing adapters ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was purified from homogenized tissues using a combination of Trizol (Tri Reagent; Molecular Research Centre, Burlington, ON, Canada) and a High Pure RNA isolation kit (Roche Scientific, Laval, QC, Canada) as described previously (30) ...
-
bioRxiv - Developmental Biology 2020Quote: Digoxigenin (DIG)-labeled and Fluorescein (Flu)-labeled in-situ probes were synthesized using in vitro transcription with Flu/DIG RNA Labeling kits respectively (Roche,Cat#11175025910, Cat#11685619910). RNA in-situ hybridization was conducted according to the published protocol 85 ...
-
bioRxiv - Genomics 2019Quote: ... were prepared by ligation of Illumina adapters on 100 ng of amplicons following the Kapa Hifi HotStart NGS library Amplification kit (Kapa Biosystems, Wilmington, MA, USA). After quantification and quality control ...
-
bioRxiv - Microbiology 2019Quote: ... PCR targeting the V4 region of archaeal 16S rRNA genes was conducted with KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cape Town, South Africa) and barcoded primer sets Arc519F/806R (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Strand-specific and barcode indexed RNA-seq libraries were then generated using the Kapa RNA-seq Hyper kit (Kapa Biosystems, Cape Town, South Africa) following the instructions of the manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... 2.5 ×105 haemocytes from each treatment/time point were added to lysis buffer (50mM potassium phosphate, 2mM EDTA, 1mM DTT and a proteinase inhibitor cocktail (Roche cOMPLETE™ Mini kit) and centrifuged at 14,000 × g for 10 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Cancer Biology 2020Quote: ... The captured libraries were quantified using KAPA Library Quantification Kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (Kapa Biosystems, catalog number KK4854) and qualified using the TapeStation D1000 ScreenTape assay (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were pooled in equimolar amounts after library quantification using both quantitative PCR with the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA, USA) and the fluorometric Qubit dsDNA high sensitivity assay kit (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: DNA protein interaction was studied with purified H-NS and DIG labeled PCR amplified PctxAB fragments by using the DIG gel shift kit (2nd Gen, Roche Aplied Science, Mannheim, Germany) as previously described (10) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Barcode-indexed sequencing libraries were generated from reverse-crosslinked ChIP-DNA samples using a Kapa Hyper DNA Library Preparation Kit (Kapa Biosystems-Roche, Basel, Switzerland) and NextFlex UDI adapters (PerkinElmer ...
-
bioRxiv - Neuroscience 2022Quote: ... and indexed libraries were created for sequencing using Truseq adapters and quantified using the Kapa universal qPCR library quantification kit (Kapa Biosystems Inc., MA, USA). Samples were sequenced on an Illumina Novaseq using a 2×100 paired-end chemistry kit (Illumina Inc. ...
-
bioRxiv - Biophysics 2022Quote: ... The PVDF membranes were developed using an enhanced chemiluminescence western blot detection kit (Pierce SuperSignal® West Dura, Rockford, IL) and exposed to Lumi-Film chemiluminescent detection films (Roche Diagnostics, Mannheim, Germany). The experiment was replicated five times ...
-
bioRxiv - Cancer Biology 2022Quote: A total amount of 1 μg total RNA per sample was used for sequencing libraries generation by using KAPA mRNA HyperPrep Kit (KAPA Biosystems, Roche, Basel, Switzerland) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Microbiology 2020Quote: ... Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was conducted using an in-situ cell death detection kit (Roche, Indianapolis, Indiana, United States) as per the manufacturer’s instructions [31,34] ...
-
bioRxiv - Neuroscience 2021Quote: ... genomic DNA was isolated from the biosamples using magnetic beads with the MagNA PureLC DNA Isolation Kit—Large Volume (Roche Diagnostics GmbH., Mannheim, Germany). Genotypes for CYP2C19 ...