Labshake search
Citations for Roche :
5001 - 5050 of 5370 citations for QuantiFluo Ammonia Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were subsequently dual indexed and amplified for 15 cycles using a KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, Ma. USA) in 50-µl reactions following the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2019Quote: ... tail clips or seminiferous tubules were digested and PCR was performed using KAPA HotStart Mouse Genotyping Kit (KAPA BIOSYSTEMS, Cat No. KK7352). The following primer pairs were used for determining genotype-Sirt1 genotyping ...
-
bioRxiv - Genetics 2019Quote: ... qRT-PCR was carried out in triplicate with the LightCycler® 480 SYBR Green I Master Kit (Roche Applied Science, Penzberg, Germany) in a 15 μ L reaction on a ABI7500 (Applied Biosystems Inc. ...
-
bioRxiv - Neuroscience 2019Quote: ... The aqueous liquid phase containing the nucleic acids was removed and added to the columns of the High Pure RNA tissue kit (Roche Diagnostics, UK). RNA was purified using repeated wash steps and DNAse treatment ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A pooled library was prepared from 10 μl of bead purified product from each population and checked with KAPA qPCR library quantification kit (KAPA Biosystems, USA); before being run on an Illumina MiSeq Sequencer using a 500-cycle pair end reagent kit (MiSeq Reagent Kits v2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mRNA capture and construction of stranded mRNA-Seq libraries were made using KAPA mRNA HyperPrep Kit according to instructions (Roche Sequencing Solutions). NGS was performed at the Whitehead Genome Technology Core (HiSeq 2500 ...
-
bioRxiv - Neuroscience 2019Quote: ... and Qiazol Lysis (Reagent cat.no.79306, Hilden, Germany) purified on MagnaPure LC (HP Kit no.03542394001, F. Hoffmann - La Roche AG, Rotkreuz, Switzerland) and amplified via real-time PCR (4ng RNA/reaction ...
-
bioRxiv - Microbiology 2019Quote: ... Fragmented DNA was transferred to a tube and library synthesis was performed with the Kapa Hyperprep kit (Kapa Biosystems, Wilmington MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Two-color in the fluorescence in situ hybridization experiment was performed following the instructions of DIG RNA Labeling Kit (Roche, Mannheim, Germany). When synthesizing probe ...
-
bioRxiv - Genomics 2020Quote: ... Chemiluminescent detection of anti-DIG was performed using CDP-Star reagents from the DIG Northern Starter Kit (Roche # 12 039 672 910). Densitometry was performed in ImageJ.
-
bioRxiv - Immunology 2021Quote: ... and high density LP (HDL) fractions were determined by enzymatic colorimetric kits (Labtest do Brasil) in a Cobas automatic analyzer (F Hoffman-La Roche, Basel, Switzerland).
-
bioRxiv - Plant Biology 2020Quote: Sequencing libraries were prepared following (Meyer and Kircher, 2010) and using the SeqCap EZ library preparation kit (Roche Nimblegen, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high- sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA of 1 μg from each sample was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... of these dilutions were used to prepare the reaction mixes for the real-time qRT-PCR using the KAPA SYBR FAST One-Step Universal kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... washing and detection were performed according to instructions of the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany).
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Plant Biology 2020Quote: ... antisense RNA probes were generated using a DIG-labeling kit and the resulting probes hydrolyzed as previously described (Roche Diagnostics, IN, USA) (36) ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were then processed for immunohistochemistry using the Discovery Ultra automated processor (Ventana Medical Systems) with a ChromoMap DAB kit (Roche Tissue Diagnostics).
-
bioRxiv - Plant Biology 2021Quote: ... and quantified by RT-qPCR in a Bio-Rad CFX384 Touch detection system using the KAPPA KK4824 kit (Kapa Biosystems, Wilmington, USA). Two 150-bp single-end sequencing libraries were prepared using the NextSeq 500/550 High Output Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS, #KK4854). Finally ...
-
bioRxiv - Neuroscience 2020Quote: Total genomic DNA was extracted from myoblasts from all participating patients using a High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2021Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of the total RNA was reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Florham Park, NJ). qPCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: ... and was used to prepare libraries for RNA sequencing using the KAPA mRNA HyperPrep Kit according to the manufacturer’s instructions (KAPA Biosystems, Wilmington, MA). Libraries were quality control checked via Qubit (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... Southern blot was performed using the DIG High Prime DNA Labeling and Detection Starter kit I according to the manufacturer’s instructions (Roche Diagnostics, Mannheim, Germany). The specific sequence was amplified from Hph gene using primer pairs (Supplemental Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... generation of TCR libraries and generation of amplicons for deep sequencing were performed using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and custom designed primers (Supplementary Table 6) ...
-
bioRxiv - Plant Biology 2021Quote: ... Target DNA capture was performed as previously described (24) with slight modifications using a SeqCap EZ Hybridisation Wash Kit (Nimblegen/Roche, Madison, USA) and Dynabeads M-270 Streptavidin (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... The sheared DNA fragments were end-repaired and deoxyadenosine-tailed in a 60 µL volume with 3 µL End Repair & A-Tailing Enzyme Mix and 7 µL End Repair & A-Tailing Buffer using a KAPA Hyper Prep Kit (KAPA Biosystems, USA) according to the manufacturer instructions (20°C 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on an QuantStudio™ 6 Flex Real-Time PCR System using a SYBR green-based real-time kit (Kapa Biosystems). The RNA polymerase II subunit ama-1 was used as the house-keeping control ...
-
bioRxiv - Molecular Biology 2022Quote: ... negative and positive samples contained an equivalent volume of HBsAg-specific diluent ([HBSAGQ2 Dil HepB] from the Elecsys HBsAg II quant II immunoassay kit (Roche Diagnostics International) and were used to exclude unknown contamination within the experimental setup and laboratory environment ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... According to the manufacturer’s protocol for Southern blot hybridization and detection digoxigenin-labeled hybridization probes (DIG DNA Labeling and Detection Kit, Roche Applied Science, 11175033910) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were scraped and lysed in lysis buffer of Pierce Crosslink IP Kit (Thermo/Pierce) with complete protease inhibitor cocktail tablet (Roche Applied Sciences). Cell lysates were incubated overnight at 4°C with anti-Myc-sepharose made with anti-Myc antibody (Cell signaling ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Pathology 2022Quote: ... was isolated from either the IFP or replacement tissue that remained in formalin-fixed paraffin-embedded blocks following acquisition of adequate sections for histopathology and immunohistochemistry (IHC) using a commercially available kit specifically designed for such (Roche, Basel, Switzerland). A custom set of guinea pig-specific probes were designed and manufactured by NanoString Technologies (Seattle ...
-
bioRxiv - Pathology 2022Quote: We detected DNA fragmentation resulting from apoptotic signaling cascades with the In Situ Cell Death Detection Kit Fluorescein (Roche, 11684795910, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Final libraries were checked for quality and quantity using the Agilent TapeStation system and qPCR using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche). Sequencing was conducted in the Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Gene expression analysis via RT-qPCR was performed using a LightCycler480 instrument and LightCycler480 SYBR Green Master Kit reagents (Roche, Indiana, IN). Relative gene expression levels were determined using a standard curve method ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed as described in Han et al., 2018 (Han et al., 2018) using KAPA SYBR® FAST qPCR Kit Master Mix on LightCycler® 96 instrument (Roche). Relative expression was calculated by dividing ACTIN2 gene expression over the specific-gene expression and the fold change was calculated by dividing estradiol expression over DMSO (mock ...
-
bioRxiv - Biochemistry 2021Quote: Cell-free histone levels were assessed in plasma from healthy controls and COVID-19 patients using a photometric enzyme immunoassay (Cell Death Detection ELISAPLUS kit, Roche Applied Science) that measures histone-associated DNA fragments according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids from these 200μL mosquito pools and from 100μL venous and finger prick whole blood samples in RNAprotect Cell Reagent were isolated using the bead-based MagNAPure LC automatic extractor (Total Nucleic Acid Isolation Kit—High Performance, Roche Applied Science) and eluted in 50μL of water ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was converted to cDNA using an oligo dT primer and the Transcriptor First Strand cDNA Synthesis kit (Roche Molecular Systems). qPCR was performed using PowerUp SYBR Green (Applied Biosystems Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the LDH release in cell culture supernatant from infected cells was measured at 24 h and 96 hpi by using the colorimetric kit (Roche, Mannheim, Germany) and following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was then provided to the Functional Genomics Laboratory at UC Berkeley where RNA-seq libraries were prepared by Oligo dT enrichment followed by a stranded Illumina library prep protocol with the KAPA mRNA HyperPrep kit (Kapa Biosystems, KK8580). Libraries were checked for quality on an AATI Fragment analyzer (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: The extent of cell death following MPP+ treatment with and without LMX1B overexpression was assessed by using the terminal deoxynucleotidyl transferase mediated dUTP-biotin nick end-labeling (TUNEL) method (In situ cell death detection kit, TMR red, Roche, Cat# 12156792910), according to the manufacturer’s protocol ...