Labshake search
Citations for Merck :
4251 - 4300 of 4581 citations for 7 Bromo 2 4 fluoro phenyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... The inoculum concentration was adjusted to 106 spores mL-1 and the resulting spore suspension was supplemented with 0.1 % of Tween 20 (Merck, UK) prior to inoculation in the field ...
-
bioRxiv - Genetics 2021Quote: In vitro treatments were carried out with different compounds: 1 μM MG-132 24 hours or 3 hours (Merck Millipore), 20 μM Chloroquine (CQ ...
-
bioRxiv - Microbiology 2021Quote: Ago2 RIPs were performed on TREx-BCBL-1 RTA cells using EZ-Magna RIP RNA binding Immunoprecipitation Kit (Merck millipore) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Whole kidneys were homogenised in 250 mM sucrose / 20 mM triethanolamine with protease inhibitors (1% Merck Protease Inhibitor Cocktail III). The homogenate was cleared of large debris by centrifugation at 4000 g for 15 mins at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mg of total protein at a 1 mg/ml concentration was incubated with 40 µl anti-FLAG-M2 affinity resin (Merck) (which had been blocked overnight with 1% BSA and 5 µl/ml ssDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... They were then incubated in 1 mL of filtered Sudan Black B working solution (0,036 % (w/v) Sudan Black B (Merck, 15928), 0.1 % phenol ...
-
bioRxiv - Biophysics 2021Quote: ... coli NA2232 grown in a M9 minimal medium supplemented with 2g/L of 13C-D-glucose (Cortecnec, France) and 1 g/L of 14N-ammonium chloride (Merck) as sole carbon and nitrogen sources ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... were transformed into Escherichia coli BL21-DE3-pLysS and expressed in 3 x 1 litre of Lucia Broth medium (Merck) supplemented with 100µg/ml ampicillin (Formedium) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human melanoma cell lines WM35 and WM793B were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution (Merck, Darmstadt, Germany). For generation of conditioned melanoma media for immune cell inhibition experiments tryptophan (Merck ...
-
bioRxiv - Immunology 2020Quote: ... After washing and incubation with unbuffered DMEM containing 25 mM D-Glucose (Carl Roth, Karlsruhe, Germany) and 1 mM Pyruvate (Merck) for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... A was 1 mM ammonium formate pH 9 (for lincomycin detection, prepared by titration of formic acid 98–100%, Merck, Germany with ammonium hydroxide 28–30% ...
-
bioRxiv - Plant Biology 2021Quote: ... Each MS medium was made by adding 1 bag of MS salt mix (Nihon pharmaceutical CO., LTD.) into the proper volume of milli-Q (Merck) water ...
-
bioRxiv - Microbiology 2019Quote: Standards of selected metabolites (Supplementary Table 1) were prepared at 10 µM in 80% acetonitrile (Hypergrade for LCMS LiChrosolv, Merck) and injected separately into a column connected to mass spectrometer interface ...
-
bioRxiv - Microbiology 2019Quote: ... 1) were cultivated according to species-specific cultivation requirements on tryptic soy agar (TSA, ReadyPlate TSA ISO, Merck Life Science) or Middlebrook agar produced in-house ...
-
bioRxiv - Immunology 2020Quote: ... The sections were blocked in PBS containing 1% bovine serum albumin (BSA) for 1 h at RT and stained in blocking buffer containing primary antibody (anti-PP6C, Merck Millipore cat ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 2h incubation with Alexa Fluor-488 goat anti-rabbit IgG secondary antibody (1:500, A11008, Merck Millipore, MA). Slices were transferred to glass slides and covered with Fluoromount (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% BR + 20% goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Merck) in the blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Biochemistry 2022Quote: ... lysates were incubated with anti-HA agarose beads (20 μl of beads per 1 mg of proteins) (Merck, Darmstadt, Germany) for 2 h ...
-
bioRxiv - Immunology 2022Quote: Decidual cells were isolated as described above and incubated in the presence of fluorescence-labeled latex beads (50 beads per cell; latex beads, 1 µm, carboxylate-modified polystyrene, fluorescent yellow-green, Merck) for 2 hours at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were blocked for 30 min in 0.3 % Triton / 10 % normal goat serum / TBS followed by overnight primary antibody incubation (1:1000; rb TH; Merck Millipore) at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001, Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... individuals were placed in 0.008% alizarin red (alizarin red S monohydrate, Waldeck Chemie, Münster, Germany) and 1% potassium hydroxide (EMSURE, Merck, Darmstadt, Germany) for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL of filtered protein extract was mixed with 40μL of anti-FLAG M2 magnetic beads (Merck, formerly Sigma-Aldrich) (equilibrated in GTEN + 0.1 % Tween-20 prior to use ...
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 2 ml 4 °C PBS for 3 times and afterwards fixed in 1 ml of −20 °C cold methanol (Gradient grade for liquid chromatography, Merck) for 5 minutes at −20 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... the amiloride-sensitive component (amilmax) was determined by adding 10 µM amiloride to the apical compartment or ouabain (1 mM, # O3125, Merck) to the basolateral chamber to calculate the maximal ouabain-sensitive Na,K-ATPase activity (ouabmax).
-
bioRxiv - Cell Biology 2024Quote: Samples were resuspended in 6 μL 40% (v/v) 1-propanol with vortexing and bath sonication were applied to Silica Gel 60 aluminium-backed HPTLC plates (MERCK) (30 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cell pellet was resuspended in 400 μl of 40 μg/ml ultra-pure digitonin (Merck, CAS 11024-24-1) in vPBS and incubated (25 min ...
-
bioRxiv - Microbiology 2023Quote: ... and peak integration was carried out with TraceFinder 4.1 software (Thermo Fischer Scientific) using confirmed retention times for 463 metabolites standardized with a library kit MSMLS-1EA (Merck). Peak smoothening was adjusted to 7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U mL−1 benzonase (Merck). After 1 h incubation at 37 °C ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the MSA agar plate was flooded and 500 µg/ml of nalidixic acid (Himedia) and 1 mg/ml of apramycin (Merck). After incubation ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequential semithin sections (1 um) were obtained and stained with a solution of 0.5% toluidine blue O (Merck, Darmstadt, Germany) for light microscopy to select cardiac regions comprising the atrioventricular canal and outflow tract ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...