Labshake search
Citations for Merck :
4201 - 4250 of 4581 citations for 7 Bromo 2 4 fluoro phenyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The obtained residue was derivatized with N-trimethylsilylimidazole/ trimethylchlorosilane reagent (TMSI:TMCS, 99:1, v/v; 50uL; both from Merck) and pyridine (50uL ...
-
bioRxiv - Microbiology 2024Quote: ... These oligonucleotides were used to create a phage display library using the T7Select 415-1 Cloning Kit (Merck Millipore) using Liga5™ (A&A Biotechnology ...
-
bioRxiv - Cancer Biology 2024Quote: The following primary antibodies and dilutions were used: mouse-anti-γH2AXSer139 1:1,000 (#05-636, clone JBW301, Merck Millipore) and rabbit-anti-53BP1 1:1,000 (NB#100-304 ...
-
bioRxiv - Plant Biology 2024Quote: ... the buffer was replaced with complex IV staining solution [1 mg/mL DAB (3,3′-Diaminobenzidine tetrahydrochloride hydrate; Merck D5637), 1 mg/mL cytochrome c (Merck C7752)] in complex IV buffer) ...
-
bioRxiv - Microbiology 2024Quote: “Swim” agar plates were made by pouring 0.3% LB agar into petri dishes with a 1-50 numbered grid sticker on them (Merck). Ciprofloxacin was added from a stock solution to each plate to a final concentration of either 0.015 μg mL-1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cells were transferred to a hypoxia chamber (InvivO2, Baker Ruskinn) set at 1% O2 and treated with increasing concentrations of PT2399 (Peloton Therapeutics/Merck) for 48 hours 22 ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 hours at 30°C with shaking 1 ml of cells was pelleted and soluble proteins were extracted using BugBuster (Merck). For internalisation experiments involving plasmid-complemented deletion strains ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample (0.5-1 ml) was transferred to Amicon Ultra 0.5 ml Centrifugal Filters (MWCO=30 kDa, Merck, cat# UFC503096) and further concentrated to a final volume of 200 μl.
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by incubation with a secondary Cy3-labeled polyclonal goat anti-rabbit antibody (AP132C, 1:800, Merck Millipore, Burlington, USA). Cells were mounted on slides using Fluoroshield™ with DAPI mounting medium (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred into polyvinylidene difluoride (PVDF) membrane in 1× Transfer buffer (Tris-base/Glycine/Methanol, Sigma-Aldrich/Merck, Poznan, Poland) using the Mini Trans-Blot® system (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... was diluted (1:1000) in 500 μl 0.1% PBST with 0.2% normal donkey serum (S30-100ML, Merck Millipore, Hertfordshire, UK) and sections were protected from light and incubated at RT with agitation for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were incubated with a solution containing 1/50 phalloidin alexa fluor 488 in PBST supplemented with 5% DMSO (Merck) and covered with parafilm (Bemis ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial inoculums were subsequently prepared using the direct colony suspension method.40 Three to five bacterial colonies were obtained from the agar plate and inoculated into an Eppendorf tube containing 1 ml of cation-adjusted Muller-Hinton broth (caMHB, Merck), consisting of 20-25 mg/L calcium ions (Ca2+ ...
-
bioRxiv - Plant Biology 2020Quote: Frozen cell pellets harvested from approximately 1 L of suspension cultures were crushed with quartz fine granules (Merck, Darmstadt, Germany) with a precooled mortar and pestle in ice-cold lysis buffer (25 mM Tris ...
-
bioRxiv - Neuroscience 2019Quote: ... A background block incubation in PBS with 1% TritonX with 10% Donkey serum was conducted before retinas were incubated in primary antibody solution (PBS with 1% Triton-X with 2.5% donkey serum with 1:250 dilution of rabbit anti-SWS cone opsin antibody, AB5407 Merck Millipore) overnight at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... for 39 weeks alone and in combination with a specific inhibitor of mPGES-1 (MF970, 10 mg/ Kg BW; a kind gift of Merck). BP was measured using the tail-cuff system as mentioned ...
-
bioRxiv - Immunology 2020Quote: ... After incubation cells were washed 3 times with PBS containing 0.5% BSA and subsequently fixed 1% (w/v) paraformaldehyde (PFA, Merck Millipore) in PBS ...
-
bioRxiv - Bioengineering 2021Quote: Isolation of fresh human PBMCs was initiated within 1 h after blood collection using Histopaque® 1077 (10771; Merck KGaA) and standard density centrifugation (800 rcf ...
-
bioRxiv - Bioengineering 2020Quote: ... we prepared a 1:1 (v/v) stock solution of MA+ in HBr by adding a methylammonium hydroxide (MAOH) solution (40% in H2O; Merck) dropwise into concentrated HBr ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissected tissue was placed in ice cold lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl pH 8, and cOmplete Mini Protease Inhibitor, Merck) and homogenized with a syringe and 20G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein pellets were resuspended in 120 μL PBS containing 1% SDS and desalted by passing through Amicon Ultra 0.5 mL 10K cutoff desalting columns (Merck Millipore) equilibrated with 1% NP-40 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000, #170-6515, Biorad or #12-349, Merck Millipore ...
-
bioRxiv - Systems Biology 2020Quote: ... The reaction was incubated at 25°C for 90 minutes followed by addition of 1 μL proteinase K (Merck, 3115887001) and incubation at 37°C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: Polar metabolites were first extracted from the frozen SHIME-samples by means of ultra pure water (0,055 μS cm-1) obtained via a purified water system (VWR International, Merck, Germany). For this purpose ...
-
bioRxiv - Microbiology 2021Quote: ... cells were allowed to adhere in a 24-well plate with poly-L-lysine-coated glass coverslips for 1 hour (Merck). After infection with labelled A ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using the qScript cDNA SuperMix (Quantabio) from 1 μg total RNA previously treated with DNase I (Merck). For droplet generation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: Reaction products and standards were dissolved in 20% 1-propanol and separated on a 10 cm HPTLC Si-60 plates (Merck) using 1-propanol:acetone:water 9:6:4 (v:v:v ...
-
bioRxiv - Cell Biology 2021Quote: ... The following day cancer cells were serum-deprived for 24h and then all cell lines were treated either with camptothecin 1-10μM (ref. C9911, CPT; Sigma-Merck, Argentina) or DMSO (ref ...
-
bioRxiv - Biophysics 2020Quote: ... The main peak fractions were pooled and concentrated to ∼1 mg/ml using an Amicon Ultra 100K filter (Merck Millipore).
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed and scraped in homemade Radioimmunoprecipitation assay buffer (RIPA) ((50 mM Tris pH 7.4, 150 mM NaCl, 1 % Triton X-100 (Merck, T9284), 2 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membrane was incubated with secondary antibody for 1 hour at room temperature and proteins were detected using chemiluminescent HRP substrate (Merck-Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTniQ was concentrated to 10 mg mL−1 using 10,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and non-expressing (d2EGFP−) cells were seeded into a 96 well plate pre-coated with 1 mg/ml Poly-D-Lysine (PDL, Merck). Aryl hydrocarbon receptor (AhR ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 h at room temperature (RT) and revealed by chemiluminescence using Immobilon Crescendo or Forte Western HRP substrate (Millipore Merck).
-
bioRxiv - Microbiology 2022Quote: ... The membranes were blocked and incubated with primary antibodies against bornavirus P (1:500) and α-tubulin (Merck, Darmstadt, Germany), followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Biophysics 2022Quote: ... For the valine-labeled sample ketoisovalerate was added to a final concentration of 40 mg L-1 together with deuterated leucine (Merck) to a final concentration of 25 mg L-1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... permeabilized for 30 minutes at room temperature in PBS supplemented with 0.2% Triton X-100 and 1% Bovine Serum Albumin (BSA) and blocked for 30 minutes at room temperature in 10% donkey serum (all from Merck). Samples were stained overnight at 4°C with the primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Explants were cultured in 35 mm tissue culture dishes pre-coated with poly-L-lysine (20 µg/ml for 1 hr; Merck) and laminin (20 µg/ml for 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Bioengineering 2021Quote: ... the cells were permeabilized with 60µL/well of 0.1% Triton X-100 for 10 minutes and stained with 50µL/well of DAPI (1:2000 dilution, in 1x PBST) (Merck, Germany) for 10 min [40] ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... “treated” cultures were grown with the addition of 0.25 µg ml-1 mitomycin C (MMC) (Merck Life Sciences UK Ltd). Mycelial pellets from untreated and treated cultures were washed in 1x PBS before lysis and RNA purification using the RNEasy Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dialyzed samples were further concentrated to 10 mg mL-1 using Amicon® Ultra-15 Centrifugal Filter Unit (Merck Millipore). The final concentration of glycerol was adjusted to 50% (v/v% ...
-
bioRxiv - Biophysics 2019Quote: ... Oryzalin-treated inflorescence meristems were obtained from plants grown on custom-made Arabidopsis medium (40) (Duchefa) supplemented with 1% agar-agar (Merck) and 10 µM N-1-naphthylphthalamic acid (NPA ...
-
bioRxiv - Microbiology 2019Quote: ... and the pellet was resuspended in 0.1 M sodium acetate buffer (pH. 6) and dialysed against four changes of buffer using Amicon ultra centrifugal filters (Merck, Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lipid extracts corresponding to 1 mg wet liver weight were applied onto HPTLC silica gel 60 plates (10 × 20 cm: Merck) and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All culture media were supplemented with either 20 g L−1 of D-glucose or maltose (both from Merck Millipore).