Labshake search
Citations for Merck :
3751 - 3800 of 3899 citations for 1 1 Ethynylcyclohexyl azetidin 1 ium 3 yl n naphthalen 1 ylcarbamatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... The purified Nup98 was concentrated to a final concentration of 165 µM using 3-kDa MWCO centrifugal filters (Merck Millipore) in a solution of 2 M GdmCl ...
-
bioRxiv - Immunology 2023Quote: ... For intracellular cytokine labelling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (50ng/ml, Merck), Ionomycin (1μg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The eluted aliquots were then desalted with filtered water and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) to remove any urea and salt residues.
-
bioRxiv - Biochemistry 2022Quote: ... as described by the manufacturer and dried down in a Speed-Vac concentrator (Thermo-Scientific) resuspended in 20 μl L/C water containing 3% acetonitrile (MeCN) (Merck) and 0.1% FA ...
-
bioRxiv - Biochemistry 2024Quote: Exoproteome fractions were concentrated to 1 mg mL-1 total protein (approximately 10 times concentration) using an Amicon Ultra-0.5 Centrifugal Filter Unit with a molecular weight cutoff of 3 kDa (Merck Millipore). A 10 µL aliquot of the concentrated exoproteome fraction was reduced with 5 mM tris (2-carboxyethyl ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were washed 3 more times with 100 µL lysis buffer 2 supplemented with 100 µg/mL polyU RNA (Merck). The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Immunology 2024Quote: ... For intracellular cytokine labelling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (50ng/ml, Merck), Ionomycin (1μg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... animals at the age of 3 months were perfused using 2% Formaldehyde (Science Services, München, Germany) and 2.5% Glutaraldehyde (Merck, Darmstadt, Germany) in 0.1M Cacodylate buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... the culture medium of the cells was replaced at day 3 with differentiation medium containing 10 mM PEG950 (Merck; P3515).
-
bioRxiv - Genomics 2023Quote: ... DNA was fragmented in a 2 mL low-bind round bottom Eppendorf tube using a sterile 3 mm borosilicate bead (Z143928-1EA Merck) by vortexing for 1 minute at maximum speed as described in [23] ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed once in ice-cold PBS and then detached with ice-cold PBS containing Sigma Phosphatase Inhibitor Cocktail 3 (539134, Merck), CoMPLETE Protease Inhibitor tablets (11873580001 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Target cells were transduced with 0.5 mL of viral supernatant in 3 mL of total medium supplemented with 8 µg/mL polybrene (Merck Sigma). 2 to 4 days post transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2023Quote: ... Blood from the dissected abdomen was absorbed onto a 3 x 20 mm piece of a Whatman FTATM card (Merck) and placed in a 2 mL tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the peak fractions were pooled and concentrated using a 3 kDa molecular weight cut off (MWCO) spin concentrator (Merck). The concentration of the protein was measured via Bradford assay against a bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2023Quote: Bone marrow supernatants (0.5 mL per sample) were concentrated with 3 kDa MWCO Amicon Ultra Centrifugal filter devices (Merck Millipore) up to a final volume of 30 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... To avoid unspecific labelling the sections were first incubated for 2 × 10 minutes in a solution of PB with 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Neuroscience 2022Quote: ... microglia were isolated and cultured for 3 days as above before cells were lysed in RIPA buffer (60 μL/well, Merck). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... the wells were rinsed 3 times with PBS and covered with 100 μL 0.5% (v/v) Triton-X 100 (Merck, 1.08603.1000) in PBS for 5 minutes to permeabilize cells ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were reseeded and enriched by selection in their respective media with an added 2.5 µg/ml of puromycin for B16-F1 and 3 µg/ml of puromycin (Merck # p9620) for Rat2 cells ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Neuroscience 2022Quote: ... slide-mounted OE sections or free-floating OB slices were washed with PBS and incubated in 3 % BSA (Merck, A2153) with 0.25 % triton and 0.02 % sodium azide (Severn Biotech Ltd ...
-
bioRxiv - Microbiology 2022Quote: ... Parasitemias were calculated from day 3 post-infection by counting infected red blood cells in blood smears stained with Hemacolor (Merck).
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... or 300 mM (octamer-mix + APLFAD) ammonium acetate at pH 7.5 using 3 kDa MWCO Amicon Ultra Centrifugal Filter Units (Merck Millipore). After buffer exchange the volume of each sample was ∼40 µL ...
-
bioRxiv - Neuroscience 2022Quote: Tissues or cells were homogenized in Pierce IP Lysis buffer supplemented with protease inhibitor cocktail 3 (Merck Millipore, Darmstadt, Germany) and phosphatase inhibitor PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) followed by size-fractionation using a 3 kDa centrifugal filter according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). The samples were kept at 4 °C or on ice throughout the process ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Biophysics 2023Quote: ... The C378A or C406A variants of 15N-pm-β2AR-Cter were labeled on the remaining cysteine using 3-(2-Iodoacetamido)-proxyl (Merck). Paramagnetic samples were recorded with a recycling delay of 2 s ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Neuroscience 2024Quote: ... or (2) collected 3 days after transfection and enriched by filter device (Amicon Ultra-15 Centrifuge Filters, Merck, Cat#UFC910008). Viral pellets were resuspended in sterile PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... the marine nanofibers were washed three times with 500 μL of ultrapure water using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The collected marine nanofibers were dropped onto a copper grid ...
-
bioRxiv - Immunology 2024Quote: Human monocytes were plated at 2 × 105 cells/well in 96 well plates and cultured for 2-3 days in RPMI supplemented with 10% human serum (from human male AB plasma, Merck), 1 U/mL penicillin and 0.1 mg/mL streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed in PBS and incubated in 0.2% Sudan black in 70% ethanol at room temperature for 3 minutes to minimize autofluorescence and mounted on glass slides (Menzel-Gläser) with FluorSave (Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... After washing 3 times for 10 minutes with PBS, slices were mounted on glass slides (J2800AMNZ, Epredia) with FluorSave (345789, Merck).
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... were percussed until the amoebae detached and 1mL of the culture media was filtered through a 3 µm cellulose acetate membrane (Merck, Germany) to retain the A ...
-
bioRxiv - Genomics 2022Quote: ... in 3×250 ml bottles and resuspended in 100 ml prewarmed 30°C YPD supplemented with 50 ug/ml Pronase (Merck 10165921001), at which point the count-up for the time course was initiated ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were transferred to 100 mM bicarbonate buffer (pH 8.2) by using Amicon® Ultra Centrifugal Filters (3 kDa MWCO, Merck, USA) and mixed with 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... rinsed four times with MTSB and treated for one hour at RT with 10% dimethylsulfoxide + 3% Igepal CA-630 (Merck # I3021) dissolved in MTSB ...
-
bioRxiv - Biochemistry 2022Quote: ... were combined and concentrated using an Amicon concentrator tube (30 kDa MWCO for the Nb- fused biosensors, 3 kDa MWCO for HER2-Nb) (Merck-Millipore). A final volume < 5 mL was loaded onto a SEC column (HiLoad 200pg ...