Labshake search
Citations for Merck :
3601 - 3650 of 3899 citations for 1 1 Ethynylcyclohexyl azetidin 1 ium 3 yl n naphthalen 1 ylcarbamatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Molecular Biology 2024Quote: ... Protein mixtures were incubated with 40μl PBST washed Streptavidin agarose resin (50% slurry, 69203-3 Merck) and incubated for 2h at room temperature on a roller ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein mixture was concentrated using Amicon Ultra 3 kDa MW cut-off device (Merck Millipore) to ∼15 mg/ml and used to set up commercial crystallisation screens using the sitting drop vapour diffusion method at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2020Quote: ... and proteins were eluted using 100 µl of 150 ng/µl 3× FLAG Peptide (F4799, Merck KGaA) or HA peptide (HY-P0239 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a LCMS-8060NX ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore catalogue no. UFC500396) and centrifuged for 45 min at 4 °C at 12,000g ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein-containing fractions were pooled and concentrated on an Amicon 3 kDa MWCO spin concentrator (Merck Millipore). After another IMAC purification step using Ni-NTA resin ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... purified ParB was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex 75 gel filtration column (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mo and PN were then washed in DMEM and placed in 3 μm Boyden chambers (Merck Millipore, France), at the concentration of 0.5 x 106 cells/chamber in 200 µl DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... purified ParBΔCTD was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex-200 gel filtration column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and HPLC separation with a ZIC®-cHILIC column (3 µm, 100 Å, 150 mm × 2.1 mm, Merck) and a similar guard column (20 mm × 2.1 mm ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... F2 FLAG-tagged TBP::NveRLR::mCherry and wild-type zygotes were treated with 3% L-Cysteine (Merck Millipore), washed and snap frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µL of sample was carefully spotted onto pre-washed PEI-cellulose TLC plates (Merck Millipore, #105725). The TLC plate was eluted in developing buffer containing 10 mM NH4Cl and 5% acetic acid for 100-140 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was up-concentrated to 3 ml using an Amicon Ultra 3000 MW centrifugal filter unit (Merck). Concentration assessment with a NanoDrop (∊ = 2980 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfections of DNA plasmids were carried out with the NanoJuice Transfection Kit (71900-3, Merck, Kenilworth, NJ, USA) or the Avalanche-Everyday Transfection Reagent (EZT-EVDY-1 ...