Labshake search
Citations for Merck :
251 - 300 of 6398 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 mM MgCl2 (Merck, #7791186), 0.3% (vol/vol ...
-
bioRxiv - Biochemistry 2020Quote: ... actin was let to polymerize in PBS for 30 min at room temperature before adding 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholiniumchloride (DMTMM, MERCK) cross-linker ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VpALDH and SlAlaR were combined (each at 0.05 μM) with 1 U mL−1 D-amino acid oxidase (DAAO) from porcine kidney (Merck product no. A5222) and 2 U mL−1 catalase from bovine liver (Merck-MilliPoreSigma ...
-
bioRxiv - Neuroscience 2021Quote: ... Microtubule-Associated Protein 2 (MAP-2) (Merck Millipore Burlington ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Cell Biology 2021Quote: The vessel lumen was washed 3 times with PBS ++ (PBS with 1mM CaCl2, 0.5mM MgCl2) and fixed with 4% paraformaldehyde (PFA, Merck, #30525-89-4) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... dimethyl sulfoxide (DMSO) (Merck), dimethylacetamide (DMAc ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX ™ (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein complex was eluted in lysis buffer 2 containing 2.5 mM D-desthiobiotin (Merck). Protein tags were removed by overnight cleavage with HRV 3C protease ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 50 µL benzaldehyde (BA) and 250 µL 3-octanol (OCT) (CAS 100-52-7, and 589-98-0, respectively; Merck, Darmstadt, Germany) were applied undiluted to 1-cm-deep Teflon containers of 5 and 14 mm diameter ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
bioRxiv - Microbiology 2024Quote: ... was obtained by using 4’,6-di-amidino-2-phenyl-indole (DAPI; Merck KGaA - Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis 14-3-3 isoforms Epsilon and Lambda were expressed using the pGEX-4T1 vector (Merck), as a translational fusion with glutathione-S-transferase (GST ...
-
bioRxiv - Microbiology 2021Quote: ... Isolated lipids were dissolved in 30 μL of chloroform:methanol (2:1, v/v) and 5 μL loaded on thin-layer chromatography (TLC) silica gel plates F254 (Merck). Lipids were separated in chloroform/methanol/water (20:4:0.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... they were washed 3 times with 1X PBS for 5 minutes and incubated with DAPI (4’6-Diamidino-2-phenylindole; 1 µg/mL, MERCK) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Mueller Hinton broth 2 (MHC-2, Merck, USA) for bacitracin susceptibility tests ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) to stop the fixation reaction.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and subsequently allowed to adhere on ICAM-1 coated glass slides before TOCCSL imaging ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck). Cells were kept on ice or seeded onto ICAM-1-coated glass slides for imaging at 37°C and in TIRF mode ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and afterwards incubated with excess amounts of mSav-cc-PS-CFP2 for 30 minutes on ice ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and subsequently allowed to adhere on ICAM-1 coated glass slides prior to imaging in TIRF mode at 22.5°C ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) and kept on ice until imaging proceeded ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) prior to imaging.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck). Cells were allowed to adhere on ICAM-1 coated glass slides for 10 minutes at 25°C before fixation ...