Labshake search
Citations for Merck :
301 - 350 of 6398 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to seeding the cells onto ICAM-1-coated glass-slides ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... with a stock solution of gramicidin A (4 mg/ml - dissolved in dimethyl sulfoxide, DMSO, Merck) to achieve a final concentration of 80 μg/mL gramicidin19 ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The purest and most concentrated fractions were then dialyzed by employing a 3 kDa membrane D-Tube Dialyzer (Merck, Germany) in PBS buffer (200 mM NaCl ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Physiology 2023Quote: ... an amount of 2 g/kg body weight D-glucose (20% solution in PBS+/+, Merck, USA) was injected ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Plant Biology 2024Quote: ... L-proline-7-amido-4-methylcoumarin hydrobromide (Pro-AMC, Merck) was used as an enzyme substrate ...
-
bioRxiv - Cell Biology 2023Quote: ... the reducing agent 2 µl 2-picoline borane complex (PB, 2 M in DMSO, Merck) and 2 µl water ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with DPBS for 5 minutes and incubated for 1 hour with respective secondary antibodies (Suppl. table 3) and DAPI (#10236276001; Merck Life Science, Dorset, UK) for nuclear counterstaining in 1% donkey serum ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 1% non-essential amino acids (Merck) in a humidified incubator at 5% CO2 and 37 °C ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... 1 × Non-Essential amino acids (Merck, M7145), 1000⍰U/ml ESGRO®LIF (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% non-essential amino acids (Merck KGaA) and 10 mM HEPES buffer (Carl Roth) ...
-
bioRxiv - Biophysics 2024Quote: ... 1% non-essential amino acids (Merck KGaA) and 10 mM HEPES buffer (Carl Roth) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Microbiology 2020Quote: ... dimethyl sulfoxide (DMSO, Merck, 99.9%), phosphate buffered solution standard tablets (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 50 µL chloroform : methanol (2 : 1) and 5 µL were loaded on silica gel 60 F254 plates (Merck). To separate trehalose esters of mycolates (TDM ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were blocked with 5% BSA in TSMT (20 mM Tris; 150 mM NaCl, Merck; 1 mM CaCl2, Sigma; 2 mM MgCl2, Merck; adjusted to pH 7 with HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (all Merck). The pH was adjusted to 7.3-7.4 (S20 ...
-
bioRxiv - Biophysics 2023Quote: ... 2-aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich/Merck, Germany), BL-1249 ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of CAA (400mM 2-Chloroacetamide (#C0267, Merck) was added ...